Tagged with #vcfcodec
1 documentation article | 0 announcements | 2 forum discussions



Created 2012-07-23 23:57:06 | Updated 2012-07-23 23:57:06 | Tags: vcfcodec gatkdocs
Comments (0)

A new tool has been released!

Check out the documentation at VCFCodec.

No posts found with the requested search criteria.

Created 2015-06-30 00:37:30 | Updated 2015-06-30 00:38:21 | Tags: combinevariants vcfcodec
Comments (6)

Hello there,

I am using CombineVariant to combine variants called by HaplotypCaller on seepage chromosomes. They come directory from the HC without any change. But my CombineVariant seems to not like the header. Please see the following errors I get which is a bit unexpected given that everything used to be working fine before GATK-v3.4 (except for now the merging options are modified and no longer working like before v3.3).

Thank you Amin Zia

java -Xmx8g -Xms8g -jar ~/gatk-3.4.0/GenomeAnalysisTK.jar -R ucsc.hg19.fasta -T CombineVariants --variant:VCF1 chrM.gatk.vcf --variant:VCF2 chr1.gatk.vcf --variant:VCF3 chr2.gatk.vcf --assumeIdenticalSamples -genotypeMergeOptions PRIORITIZE -priority VCF1,VCF2,VCF3 -o genome.gatk.vcf

INFO 17:25:36,611 HelpFormatter - -------------------------------------------------------------------------------- INFO 17:25:36,613 HelpFormatter - The Genome Analysis Toolkit (GATK) v3.4-0-g7e26428, Compiled 2015/05/15 03:25:41 INFO 17:25:36,613 HelpFormatter - Copyright (c) 2010 The Broad Institute INFO 17:25:36,613 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk INFO 17:25:36,619 HelpFormatter - Program Args: -R /srv/gs1/projects/scg/Resources/GATK/hg19-3.0//ucsc.hg19.fasta -T CombineVariants --variant:VCF1 chrM.gatk.vcf --variant:VCF2 chr1.gatk.vcf --variant:VCF3 chr2.gatk.vcf --assumeIdenticalSamples -genotypeMergeOptions PRIORITIZE -priority VCF1,VCF2,VCF3 -o genome.gatk.vcf INFO 17:25:36,622 HelpFormatter - Executing as aminzia@greenie.local on Linux 2.6.32-504.16.2.el6.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.7.0_03-b04. INFO 17:25:36,622 HelpFormatter - Date/Time: 2015/06/29 17:25:36 INFO 17:25:36,622 HelpFormatter - -------------------------------------------------------------------------------- INFO 17:25:36,622 HelpFormatter - -------------------------------------------------------------------------------- INFO 17:25:37,369 GenomeAnalysisEngine - Strictness is SILENT INFO 17:25:37,518 GenomeAnalysisEngine - Downsampling Settings: Method: BY_SAMPLE, Target Coverage: 1000 INFO 17:25:38,886 GATKRunReport - Uploaded run statistics report to AWS S3

ERROR ------------------------------------------------------------------------------------------
ERROR A USER ERROR has occurred (version 3.4-0-g7e26428):
ERROR
ERROR This means that one or more arguments or inputs in your command are incorrect.
ERROR The error message below tells you what is the problem.
ERROR
ERROR If the problem is an invalid argument, please check the online documentation guide
ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
ERROR
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
ERROR
ERROR MESSAGE: Unable to parse header with error: Your input file has a malformed header: This codec is strictly for VCFv3 and does not support VCFv4.1, for input source: chr2.gatk.vcf
ERROR ------------------------------------------------------------------------------------------

Created 2013-10-24 15:22:35 | Updated | Tags: vcfcodec tribble bug strelka breakend
Comments (7)

I'm running into a problem with vcfs that have single ended break ends. (These are produced by an old version of Strelka .) Tribble doesn't recognize "." as valid in alternative alleles.

Single break ends are valid in the vcf standard and the files validate according to Vcftools.

Others have run into this problem as well: https://groups.google.com/forum/#!searchin/strelka-discuss/gatk/strelka-discuss/gJfsyjZNZXA/ExDXZiVWW_kJ

example error

##### ERROR stack trace
org.broad.tribble.TribbleException: The provided VCF file is malformed at approximately line number 1807: Unparsable vcf record with allele .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC, for input source: /cga/tcga-gsc/benchmark/Indels/strelkaPON/NA18606.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam-NA18608.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam/final.indels.vcf
at org.broadinstitute.variant.vcf.AbstractVCFCodec.generateException(AbstractVCFCodec.java:715)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.checkAllele(AbstractVCFCodec.java:527)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseSingleAltAllele(AbstractVCFCodec.java:553)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseAlleles(AbstractVCFCodec.java:494)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseVCFLine(AbstractVCFCodec.java:291)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decodeLine(AbstractVCFCodec.java:234)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:213)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:45)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:73)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:35)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.readNextRecord(TribbleIndexedFeatureReader.java:284)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:264)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:225)
at org.broadinstitute.sting.tools.CatVariants.execute(CatVariants.java:239)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sting.tools.CatVariants.main(CatVariants.java:258)
##### ERROR ------------------------------------------------------------------------------------------

Example vcf line

19  36002413    .   C   .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC    .   PASS    IHP=1;NT=ref;QSI=82;QSI_NT=82;SGT=ref->hom;SOMATIC;SVTYPE=BND;TQSI=1;TQSI_NT=1  DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50   49:49:42,44:0,0:7,6:43.72:0.85:0.00 11:11:0,0:6,6:5,5:14.61:0.48:0.0

A full vcf is available at: /humgen/gsa-scr1/pub/incoming/BreakendBug/breakend.vcf