Tagged with #tribble
3 documentation articles | 0 announcements | 5 forum discussions

Created 2013-02-13 18:06:06 | Updated 2014-06-24 09:45:27 | Tags: tribble picard sam-jdk variantcontext htsjdk
Comments (1)

The picard repository on github contains all picard public tools. Libraries live under the htsjdk, which includes the samtools-jdk, tribble, and variant packages (which includes VariantContext and associated classes as well as the VCF/BCF codecs).

If you just need to check out the sources and don't need to make any commits into the picard repository, the command is:

git clone https://github.com/broadinstitute/picard.git

Then within the picard directory, clone the htsjdk.

cd picard
git clone https://github.com/samtools/htsjdk.git

Then you can attach the picard/src/java and picard/htsjdk/src/java directories in IntelliJ as a source directory (File -> Project Structure -> Libraries -> Click the plus sign -> "Attach Files or Directories" in the latest IntelliJ).

To build picard and the htsjdk all at once, type ant from within the picard directory. To run tests, type ant test

If you do need to make commits into the picard repository, first you'll need to create a github account, fork picard or htsjdk, make your changes, and then issue a pull request. For more info on pull requests, see: https://help.github.com/articles/using-pull-requests

Created 2012-08-15 18:19:11 | Updated 2012-10-18 15:23:11 | Tags: official developer tribble rod intermediate
Comments (2)

Brief introduction to reference metadata (RMDs)

Note that the -B flag referred to below is deprecated; these docs need to be updated

The GATK allows you to process arbitrary numbers of reference metadata (RMD) files inside of walkers (previously we called this reference ordered data, or ROD). Common RMDs are things like dbSNP, VCF call files, and refseq annotations. The only real constraints on RMD files is that:

  • They must contain information necessary to provide contig and position data for each element to the GATK engine so it knows with what loci to associate the RMD element.

  • The file must be sorted with regard to the reference fasta file so that data can be accessed sequentially by the engine.

  • The file must have a Tribble RMD parsing class associated with the file type so that elements in the RMD file can be parsed by the engine.

Inside of the GATK the RMD system has the concept of RMD tracks, which associate an arbitrary string name with the data in the associated RMD file. For example, the VariantEval module uses the named track eval to get calls for evaluation, and dbsnp as the track containing the database of known variants.

How do I get reference metadata files into my walker?

RMD files are extremely easy to get into the GATK using the -B syntax:

java -jar GenomeAnalysisTK.jar -R Homo_sapiens_assembly18.fasta -T PrintRODs -B:variant,VCF calls.vcf

In this example, the GATK will attempt to parse the file calls.vcf using the VCF parser and bind the VCF data to the RMD track named variant.

In general, you can provide as many RMD bindings to the GATK as you like:

java -jar GenomeAnalysisTK.jar -R Homo_sapiens_assembly18.fasta -T PrintRODs -B:calls1,VCF calls1.vcf -B:calls2,VCF calls2.vcf

Works just as well. Some modules may require specifically named RMD tracks -- like eval above -- and some are happy to just assess all RMD tracks of a certain class and work with those -- like VariantsToVCF.

1. Directly getting access to a single named track

In this snippet from SNPDensityWalker, we grab the eval track as a VariantContext object, only for the variants that are of type SNP:

public Pair<VariantContext, GenomeLoc> map(RefMetaDataTracker tracker, ReferenceContext ref, AlignmentContext context) {
    VariantContext vc = tracker.getVariantContext(ref, "eval", EnumSet.of(VariantContext.Type.SNP), context.getLocation(), false);

2. Grabbing anything that's convertable to a VariantContext

From VariantsToVCF we call the helper function tracker.getVariantContexts to look at all of the RMDs and convert what it can to VariantContext objects.

Allele refAllele = new Allele(Character.toString(ref.getBase()), true);
Collection<VariantContext> contexts = tracker.getVariantContexts(INPUT_RMD_NAME, ALLOWED_VARIANT_CONTEXT_TYPES, context.getLocation(), refAllele, true, false);

3. Looking at all of the RMDs

Here's a totally general code snippet from PileupWalker.java. This code, as you can see, iterates over all of the GATKFeature objects in the reference ordered data, converting each RMD to a string and capturing these strings in a list. It finally grabs the dbSNP binding specifically for a more detailed string conversion, and then binds them all up in a single string for display along with the read pileup.

private String getReferenceOrderedData( RefMetaDataTracker tracker ) { ArrayList rodStrings = new ArrayList(); for ( GATKFeature datum : tracker.getAllRods() ) { if ( datum != null && ! (datum.getUnderlyingObject() instanceof DbSNPFeature)) { rodStrings.add(((ReferenceOrderedDatum)datum.getUnderlyingObject()).toSimpleString()); // TODO: Aaron: this line still survives, try to remove it } } String rodString = Utils.join(", ", rodStrings);

        DbSNPFeature dbsnp = tracker.lookup(DbSNPHelper.STANDARD_DBSNP_TRACK_NAME, DbSNPFeature.class);

        if ( dbsnp != null)
            rodString += DbSNPHelper.toMediumString(dbsnp);

        if ( !rodString.equals("") )
            rodString = "[ROD: " + rodString + "]";

        return rodString;

How do I write my own RMD types?

Tracks of reference metadata are loaded using the Tribble infrastructure. Tracks are loaded using the feature codec and underlying type information. See the Tribble documentation for more information.

Tribble codecs that are in the classpath are automatically found; the GATK discovers all classes that implement the FeatureCodec class. Name resolution occurs using the -B type parameter, i.e. if the user specified:

-B:calls1,VCF calls1.vcf

The GATK looks for a FeatureCodec called VCFCodec.java to decode the record type. Alternately, if the user specified:

-B:calls1,MYAwesomeFormat calls1.maft

THe GATK would look for a codec called MYAwesomeFormatCodec.java. This look-up is not case sensitive, i.e. it will resolve MyAwEsOmEfOrMaT as well, though why you would want to write something so painfully ugly to read is beyond us.

Created 2012-08-15 18:16:01 | Updated 2014-09-17 13:20:21 | Tags: official developer tribble intermediate picard htsjdk
Comments (6)

1. Overview

The Tribble project was started as an effort to overhaul our reference-ordered data system; we had many different formats that were shoehorned into a common framework that didn't really work as intended. What we wanted was a common framework that allowed for searching of reference ordered data, regardless of the underlying type. Jim Robinson had developed indexing schemes for text-based files, which was incorporated into the Tribble library.

2. Architecture Overview

Tribble provides a lightweight interface and API for querying features and creating indexes from feature files, while allowing iteration over know feature files that we're unable to create indexes for. The main entry point for external users is the BasicFeatureReader class. It takes in a codec, an index file, and a file containing the features to be processed. With an instance of a BasicFeatureReader, you can query for features that span a specific location, or get an iterator over all the records in the file.

3. Developer Overview

For developers, there are two important classes to implement: the FeatureCodec, which decodes lines of text and produces features, and the feature class, which is your underlying record type.

For developers there are two classes that are important:

  • Feature

    This is the genomicly oriented feature that represents the underlying data in the input file. For instance in the VCF format, this is the variant call including quality information, the reference base, and the alternate base. The required information to implement a feature is the chromosome name, the start position (one based), and the stop position. The start and stop position represent a closed, one-based interval. I.e. the first base in chromosome one would be chr1:1-1.

  • FeatureCodec

    This class takes in a line of text (from an input source, whether it's a file, compressed file, or a http link), and produces the above feature.

To implement your new format into Tribble, you need to implement the two above classes (in an appropriately named subfolder in the Tribble check-out). The Feature object should know nothing about the file representation; it should represent the data as an in-memory object. The interface for a feature looks like:

public interface Feature {

     * Return the features reference sequence name, e.g chromosome or contig
    public String getChr();

     * Return the start position in 1-based coordinates (first base is 1)
    public int getStart();

     * Return the end position following 1-based fully closed conventions.  The length of a feature is
     * end - start + 1;
    public int getEnd();

And the interface for FeatureCodec:

 * the base interface for classes that read in features.
 * @param <T> The feature type this codec reads
public interface FeatureCodec<T extends Feature> {
     * Decode a line to obtain just its FeatureLoc for indexing -- contig, start, and stop.
     * @param line the input line to decode
     * @return  Return the FeatureLoc encoded by the line, or null if the line does not represent a feature (e.g. is
     * a comment)
    public Feature decodeLoc(String line);

     * Decode a line as a Feature.
     * @param line the input line to decode
     * @return  Return the Feature encoded by the line,  or null if the line does not represent a feature (e.g. is
     * a comment)
    public T decode(String line);

     * This function returns the object the codec generates.  This is allowed to be Feature in the case where
     * conditionally different types are generated.  Be as specific as you can though.
     * This function is used by reflections based tools, so we can know the underlying type
     * @return the feature type this codec generates.
    public Class<T> getFeatureType();

    /**  Read and return the header, or null if there is no header.
     * @return header object
    public Object readHeader(LineReader reader);

4. Supported Formats

The following formats are supported in Tribble:

  • VCF Format
  • DbSNP Format
  • BED Format
  • GATK Interval Format

5. Updating the Tribble, htsjdk, and/or Picard library

Updating the revision of Tribble on the system is a relatively straightforward task if the following steps are taken.

NOTE: Any directory starting with ~ may be different on your machine, depending on where you cloned the various repositories for gsa-unstable, picard, and htsjdk.

A Maven script to install picard into the local repository is located under gsa-unstable/private/picard-maven. To operate, it requires a symbolic link named picard pointing to a working checkout of the picard github repository. NOTE: compiling picard requires an htsjdk github repository checkout available at picard/htsjdk, either as a subdirectory or another symbolic link. The final full path should be gsa-unstable/private/picard-maven/picard/htsjdk.

cd ~/src/gsa-unstable
cd private/picard-maven
ln -s ~/src/picard picard

Create a git branch of Picard and/or htsjdk and make your changes. To install your changes into the GATK you must run mvn install in the private/picard-maven directory. This will compile and copy the jars into gsa-unstable/public/repo, and update gsa-unstable/gatk-root/pom.xml with the corresponding version. While making changes your revision of picard and htslib will be labeled with -SNAPSHOT.

cd ~/src/gsa-unstable
cd private/picard-maven
mvn install

Continue testing in the GATK. Once your changes and updated tests for picard/htsjdk are complete, push your branch and submit your pull request to the Picard and/or htsjdk github. After your Picard/htsjdk patches are accepted, switch your Picard/htsjdk branches back to the master branch. NOTE: Leave your gsa-unstable branch on your development branch!

cd ~/src/picard
ant clean
git checkout master
git fetch
git rebase
cd htsjdk
git checkout master
git fetch
git rebase

NOTE: The version number of old and new Picard/htsjdk will vary, and during active development will end with -SNAPSHOT. While, if needed, you may push -SNAPSHOT version for testing on Bamboo, you should NOT submit a pull request with a -SNAPSHOT version. -SNAPSHOT indicates your local changes are not reproducible from source control.

When ready, run mvn install once more to create the non -SNAPSHOT versions under gsa-unstable/public/repo. In that directory, git add the new version, and git rm the old versions.

cd ~/src/gsa-unstable
cd public/repo
git add picard/picard/1.115.1499/
git add samtools/htsjdk/1.115.1509/
git rm -r picard/picard/1.112.1452/
git rm -r samtools/htsjdk/1.112.1452/

Commit and then push your gsa-unstable branch, then issue a pull request for review.

No posts found with the requested search criteria.

Created 2015-10-16 19:36:43 | Updated 2015-10-16 19:38:30 | Tags: tribble mutect-analysis
Comments (6)

hi all

I'm trying to run MuTect over paired tumor-normal bam files but I can't get past the following error:

ERROR A USER ERROR has occurred (version 2.2-25-g2a68eab) ERROR MESSAGE: Invalid command line: No tribble type was provided on the command line and the type of the file could not be determined dynamically. Please add an explicit type tag :NAME listing the correct type from among the supported types:

ERROR Name FeatureType Documentation
ERROR BCF2 VariantContext http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_utils_codecs_bcf2_BCF2Codec.html
ERROR VCF VariantContext http://www.broadinstitute.org/gatk/gatkdocs/org_broadinstitute_sting_utils_codecs_vcf_VCFCodec.html

none of the links actually sends to a working page. the command line is the following:

java -jar muTect-1.1.4.jar \ --analysis_type MuTect \ --reference_sequence /genomes/hg19_reordered.fa \ --dbsnp dbsnp_138_hg19_reordered.vcf \ --cosmic b37_cosmic_v54_120711_reordered.vcf \ --input_file /ExomeSeq/Normal_sorted_group.bam \ --input_file /ExomeSeq/Tumor_sorted_group.bam \ --out /ExomeSeq/MuTectOutput/calls.txt \ --coverage_file ExomeSeq/MuTectOutput/coverage.txt

and the "reordered" simply indicates that the chrs are in the order 1-->22,X,Y,M

any help would be golden

Created 2015-08-07 05:18:13 | Updated | Tags: applyrecalibration validatevariants tribble
Comments (2)

I'm trying to use ApplyRecalibration and I get the following error: ERROR MESSAGE: Invalid command line: No tribble type was provided on the command line and the type of the file could not be determined dynamically. Please add an explicit type tag :NAME listing the correct type from among the supported types

I validated it with ValidateVariants and got no errors wrong with the file: Successfully validated the input file. Checked 1592 records with no failures.

My code for the ApplyRecalibration is this gatk -T ApplyRecalibration -R ucsc.hg19.fasta -input L7_Genotyped.vcf -mode SNP -recalFile L7.SNP.recal -tranchesFile L7.SNP.tranches -o L7.recal.SNPS.vcf -ts_filter_level 99.0

I'm using GATK 3.3.0, my supercomputing cluster doesn't have a newer version installed.

Every thing I've seen from the GATK team has been to validate the VCF file. I've done that and gotten no errors; the VCF file was generated using GenotypeGVCFs, so what's going on?

Created 2014-10-29 13:07:43 | Updated 2014-10-29 13:11:42 | Tags: applyrecalibration tribble variantrecalibration gatk3
Comments (2)

Hi there,

I'm having a problem using GATK's ApplyRecalibration tool using this command:

java -jar "GenomeAnalysisTK.jar" -T "ApplyRecalibration" -R human_g1k_v37.fasta -input fileContents.vcf --ts_filter_level "99.9" --mode "SNP" --recal_file dataset_1139.dat_0.recal --tranches_file dataset_1140.dat_0.tranches --out dataset_1142.dat_0.vcf

This is the error:

ERROR ------------------------------------------------------------------------------------------
ERROR A USER ERROR has occurred (version 3.3-0-g37228af):
ERROR This means that one or more arguments or inputs in your command are incorrect.
ERROR The error message below tells you what is the problem.
ERROR If the problem is an invalid argument, please check the online documentation guide
ERROR (or rerun your command with --help) to view allowable command-line arguments for this tool.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR Please do NOT post this error to the GATK forum unless you have really tried to fix it yourself.
ERROR MESSAGE: Invalid command line: No tribble type was provided on the command line and the type of the file could not be determined dynamically. Please add an explicit type tag :NAME listing the correct type from among the supported types:
ERROR Name FeatureType Documentation
ERROR BCF2 VariantContext (this is an external codec and is not documented within GATK)
ERROR VCF VariantContext (this is an external codec and is not documented within GATK)
ERROR VCF3 VariantContext (this is an external codec and is not documented within GATK)
ERROR ------------------------------------------------------------------------------------------

I tried to look for some solutions, I added a :NAME,VCF tag before the vcf file, I tried using another vcf file and I validated the vcf file I'm using, using GATK's ValidateVariants and it was validated with no problem, I tried different versions of GATK including the current version 3.3, and I tried compressing and indexing the vcf file unsing bgzip+tabix but this problem still presists.

The weird thing is that in the log info I get this message before the error: INFO 14:21:11,775 ArgumentTypeDescriptor - Dynamically determined type of fileContents.vcf to be VCF

Any suggestions are appreciated.

Thanks in advance.

Created 2013-10-24 15:22:35 | Updated | Tags: vcfcodec tribble bug strelka breakend
Comments (7)

I'm running into a problem with vcfs that have single ended break ends. (These are produced by an old version of Strelka .) Tribble doesn't recognize "." as valid in alternative alleles.

Single break ends are valid in the vcf standard and the files validate according to Vcftools.

Others have run into this problem as well: https://groups.google.com/forum/#!searchin/strelka-discuss/gatk/strelka-discuss/gJfsyjZNZXA/ExDXZiVWW_kJ

example error

##### ERROR stack trace
org.broad.tribble.TribbleException: The provided VCF file is malformed at approximately line number 1807: Unparsable vcf record with allele .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC, for input source: /cga/tcga-gsc/benchmark/Indels/strelkaPON/NA18606.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam-NA18608.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam/final.indels.vcf
at org.broadinstitute.variant.vcf.AbstractVCFCodec.generateException(AbstractVCFCodec.java:715)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.checkAllele(AbstractVCFCodec.java:527)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseSingleAltAllele(AbstractVCFCodec.java:553)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseAlleles(AbstractVCFCodec.java:494)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseVCFLine(AbstractVCFCodec.java:291)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decodeLine(AbstractVCFCodec.java:234)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:213)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:45)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:73)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:35)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.readNextRecord(TribbleIndexedFeatureReader.java:284)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:264)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:225)
at org.broadinstitute.sting.tools.CatVariants.execute(CatVariants.java:239)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sting.tools.CatVariants.main(CatVariants.java:258)
##### ERROR ------------------------------------------------------------------------------------------

Example vcf line

19  36002413    .   C   .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC    .   PASS    IHP=1;NT=ref;QSI=82;QSI_NT=82;SGT=ref->hom;SOMATIC;SVTYPE=BND;TQSI=1;TQSI_NT=1  DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50   49:49:42,44:0,0:7,6:43.72:0.85:0.00 11:11:0,0:6,6:5,5:14.61:0.48:0.0

A full vcf is available at: /humgen/gsa-scr1/pub/incoming/BreakendBug/breakend.vcf

Created 2012-08-26 06:56:33 | Updated 2013-01-07 20:44:36 | Tags: unifiedgenotyper tribble error
Comments (19)

Hi all,

I've been analyzing some illumina whole exome sequencing data these days. Yesterday I used GATK(version 2.0) UnifiedGenotyper to call snps and indels with the following commands:

run_gatk.sh -T UnifiedGenotyper -R GRCh37/human_g1k_v37.fasta -I GATK_recal_result.bam -glm BOTH --dbsnp reference/dbsnp_134.b37.vcf -stand_call_conf 50 -stand_emit_conf 10 -o raw2.vcf -dcov 200 --num_threads 10

After running theses commands, I got a vcf file which is very small(when I checked the vcf file, I found these called snps and indels are all from Chromosome1) The error message is as follows:

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

org.broadinstitute.sting.utils.exceptions.ReviewedStingException: Unable to merge temporary Tribble output file. at org.broadinstitute.sting.gatk.executive.HierarchicalMicroScheduler.mergeExistingOutput(HierarchicalMicroScheduler.java:269) at org.broadinstitute.sting.gatk.executive.HierarchicalMicroScheduler.execute(HierarchicalMicroScheduler.java:105) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:269) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:236) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:146) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:93) Caused by: org.broad.tribble.TribbleException$MalformedFeatureFile: Unable to parse header with error: /rd/tmp/org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub8005277156701491219.tmp (Too many open files), for input source: /rd/tmp/org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub8005277156701491219.tmp at org.broad.tribble.TribbleIndexedFeatureReader.readHeader(TribbleIndexedFeatureReader.java:104) at org.broad.tribble.TribbleIndexedFeatureReader.(TribbleIndexedFeatureReader.java:58) at org.broad.tribble.AbstractFeatureReader.getFeatureReader(AbstractFeatureReader.java:69) at org.broadinstitute.sting.gatk.io.storage.VariantContextWriterStorage.mergeInto(VariantContextWriterStorage.java:182) at org.broadinstitute.sting.gatk.io.storage.VariantContextWriterStorage.mergeInto(VariantContextWriterStorage.java:52) at org.broadinstitute.sting.gatk.executive.OutputMergeTask.merge(OutputMergeTask.java:48) at org.broadinstitute.sting.gatk.executive.HierarchicalMicroScheduler.mergeExistingOutput(HierarchicalMicroScheduler.java:263) ... 6 more Caused by: java.io.FileNotFoundException: /rd/tmp/org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub8005277156701491219.tmp (Too many open files) at java.io.FileInputStream.open(Native Method) at java.io.FileInputStream.(FileInputStream.java:120) at org.broad.tribble.util.ParsingUtils.openInputStream(ParsingUtils.java:56) at org.broad.tribble.TribbleIndexedFeatureReader.readHeader(TribbleIndexedFeatureReader.java:96) ... 12 more

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.0-39-gd091f72):
ERROR Please visit the wiki to see if this is a known problem
ERROR If not, please post the error, with stack trace, to the GATK forum
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR MESSAGE: Unable to merge temporary Tribble output file.
ERROR ------------------------------------------------------------------------------------------

Would you please help me solve it ? Thanks a lot