Tagged with #malformedbam
0 documentation articles | 0 announcements | 3 forum discussions


No articles to display.

No articles to display.


Created 2015-03-15 21:46:07 | Updated | Tags: indelrealigner malformedbam

Comments (1)

Hi Team,

I get an error with gatk in variant calling steps, using BAM file from realignment step. The error indicated something wrong with the bai file. So I tried to create it new. But then this comes up, saying there is something wrong with the bam (see below) This bam was created with IndelRealigner (no errors)

Thanks! Alexander

$ picard 1 BuildBamIndex INPUT=B57.3.bam
[Sun Mar 15 22:37:46 CET 2015] picard.sam.BuildBamIndex INPUT=B57.3.bam    VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
[Sun Mar 15 22:37:46 CET 2015] Executing as kaktus42@soroban on Linux 2.6.32-431.29.2.el6.x86_64 amd64; Java HotSpot(TM) 64-Bit Server VM 1.8.0_31-b13; Picard version: 1.129(b508b2885562a4e932d3a3a60b8ea283b7ec78e2_1424706677) IntelDeflater
[Sun Mar 15 22:41:19 CET 2015] picard.sam.BuildBamIndex done. Elapsed time: 3,55 minutes.
Runtime.totalMemory()=855638016
To get help, see http://broadinstitute.github.io/picard/index.html#GettingHelp
Exception in thread "main" htsjdk.samtools.FileTruncatedException: Premature end of file
    at htsjdk.samtools.util.BlockCompressedInputStream.readBlock(BlockCompressedInputStream.java:382)
    at htsjdk.samtools.util.BlockCompressedInputStream.available(BlockCompressedInputStream.java:127)
    at htsjdk.samtools.util.BlockCompressedInputStream.read(BlockCompressedInputStream.java:252)
    at java.io.DataInputStream.read(DataInputStream.java:149)
    at htsjdk.samtools.util.BinaryCodec.readBytesOrFewer(BinaryCodec.java:404)
    at htsjdk.samtools.util.BinaryCodec.readBytes(BinaryCodec.java:380)
    at htsjdk.samtools.util.BinaryCodec.readBytes(BinaryCodec.java:366)
    at htsjdk.samtools.BAMRecordCodec.decode(BAMRecordCodec.java:199)
    at htsjdk.samtools.BAMFileReader$BAMFileIterator.getNextRecord(BAMFileReader.java:660)
    at htsjdk.samtools.BAMFileReader$BAMFileIterator.advance(BAMFileReader.java:634)
    at htsjdk.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:628)
    at htsjdk.samtools.BAMFileReader$BAMFileIterator.next(BAMFileReader.java:598)
    at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:527)
    at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:501)
    at htsjdk.samtools.BAMIndexer.createIndex(BAMIndexer.java:287)
    at htsjdk.samtools.BAMIndexer.createIndex(BAMIndexer.java:271)
    at picard.sam.BuildBamIndex.doWork(BuildBamIndex.java:138)
    at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:187)
    at picard.cmdline.PicardCommandLine.instanceMain(PicardCommandLine.java:95)
    at picard.cmdline.PicardCommandLine.main(PicardCommandLine.java:105)

Created 2013-01-17 11:00:53 | Updated | Tags: unifiedgenotyper malformedbam

Comments (3)

Hallo,

I running a pipline for exome data. I have 7 exome samples. When the pipeline arrive at the UnifiedGenotyper i always get the error my bam files are malformed.

MESSAGE: SAM/BAM file /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261951.recal.bam is malformed: BGZF file has invalid uncompressedLength: -1792842732

All the bam files have are serveral GB big. So I do not get i why the uncompressed length is negative. Here is what is executed:

java -Xmx8g -jar /lib/gatk/GenomeAnalysisTK-2.1-13-g1706365/GenomeAnalysisTK.jar -T UnifiedGenotyper -R /tmp/db99fcb54f49eea7ce46ff16a802f7ac/human_g1k_v37.fasta -nt 30 -glm BOTH -A AlleleBalance -A DepthOfCoverage -A FisherStrand -D /tmp/db99fcb54f49eea7ce46ff16a802f7ac/dbsnp_135.b37.vcf -o samples.variants.raw.vcf -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261951.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261953.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261952.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261954.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261950.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261955.recal.bam -I /tmp/db99fcb54f49eea7ce46ff16a802f7ac/ISDBM261956.recal.bam

Thanks,

Robin


Created 2012-10-01 20:44:55 | Updated 2013-01-07 20:35:36 | Tags: malformedbam

Comments (5)

Hi,

I run into an error at step of IndelRealigner for GATK v2.0 complaining about SAM/BAM file has inconsistent mapping information

here is the command I used (take out full path for clarity):

java -Xmx4g -jar /Path/GenomeAnalysisTK-2.1-8-g5efb575/bin/GenomeAnalysisTK.jar -T IndelRealigner -I /Path/myBam.bam -R /path/hg19.fa -targetIntervals /path/myBam.output.intervals -o /Path/my_realignedBam.bam -known /Path/bundle-1.5/hg19/Mills_and1000G gold_standard.indels.hg19.sites.vcf -known /Path/bundle-1.5/hg19/1000G_phase1.indels.hg19.vcf

Here is the error message I encountered: ...

ERROR MESSAGE: SAM/BAM file SAMFileReader{/Path/myBam.bam} is malformed: read NCI-GA1:30:70BETAAXX:2:114

:10000:10163 145 chr1 37 108M chr14 59648529 GCAAGACCAACAAGAAGATCGCCATTGCTAACTGTGGACAACTCTAATAAATTTGGCTTGTGTTTTATCTTAGCCACCACACTGTTCTTTCTG TAGCTCAAGAGAGTA @?BB6>EC@BCB@DB@;=8BAB<8BDDDEFIIHEIHI>I<IIDHHIHDIIII@GIDIIIIICIIHIHIHIIIIIIBIIHIIDIHIIIIIIFIDI has inconsistent mapping information.

ERROR ------------------------------------------------------------------------------------------

...

Anybody encountered similar issue? Advice would be greatly appreciated!

Mike