Tagged with #bwa
0 documentation articles | 0 announcements | 7 forum discussions


No articles to display.

No articles to display.


Created 2015-07-29 18:59:07 | Updated | Tags: bwa picard

Comments (2)

I noticed that the current build of picard contains a 3rd party version of bwa 0.5.9-r16, the version.txt which contains the text:

"patched by AW, and multithread samse/sampe patch applied."

I have an external collaborator who is interested in applying this patch. Could someone provide download and instructions for doing so, or for accessing this patched version of BWA? Or can I just send the bwa executable directly to the collaborator?

Thanks!


Created 2015-02-18 16:59:33 | Updated | Tags: bwa revert split

Comments (2)

Hi guys, we are presently building some simulation program in our lab presently and we were wondering if there's already a program known by the community or done by GATK's team to revert back the bam files containing splitted spliced reads like what is outputted by the Split'N'trim step?

I'm asking because we are testing multiple programs to map RNAseq reads and bwa is outputting splitted reads directly and we want to revert them back to reads with N Cigar operators.

Thanks a lot for your help!


Created 2014-01-20 19:28:37 | Updated | Tags: bwa mapping rna-seq

Comments (1)

Hi all,

My question is on bwa software when one want to map RNA-seq data on the entire human genome. What should be the specific settings to use to get maximum mapping? Should it be effective if no options are used in the command line?

Thank you for your time


Created 2013-12-16 11:41:23 | Updated | Tags: baserecalibrator bam bwa

Comments (1)

We have used bwa 0.7.4 aln and sampe to align illumina reads. Then used the following command java -Xmx6g -jar ~/GenomeAnalysisTK-2.8-1/GenomeAnalysisTK.jar -T BaseRecalibrator -I ~/temp/BIR-08_130330_I288_FCD1P68ACXX_L7_SZAIPI025187-74.sortedindelrealigned.bam -R ~/hg19/ucsc.hg19.fasta -knownSites ~/dbSNP/dbsnp_137.hg19.vcf -o ~/BIR-08_130330_I288_FCD1P68ACXX_L7_SZAIPI025187-74.sortedBQSR.grp Which gave the following error message

ERROR ------------------------------------------------------------------------------------------
ERROR stack trace

org.broadinstitute.sting.utils.exceptions.ReviewedStingException: START (90) > (89) STOP -- this should never happen, please check read: FCD1P68ACXX:7:1315:19572:52424#CGCGGTGA 1/2 90b aligned read. (CIGAR: 85M4I1M2D) at org.broadinstitute.sting.utils.clipping.ReadClipper.hardClipByReferenceCoordinates(ReadClipper.java:537) at org.broadinstitute.sting.utils.clipping.ReadClipper.hardClipByReferenceCoordinatesRightTail(ReadClipper.java:193) at org.broadinstitute.sting.utils.clipping.ReadClipper.hardClipAdaptorSequence(ReadClipper.java:389) at org.broadinstitute.sting.utils.clipping.ReadClipper.hardClipAdaptorSequence(ReadClipper.java:392) at org.broadinstitute.sting.gatk.walkers.bqsr.BaseRecalibrator.map(BaseRecalibrator.java:245) at org.broadinstitute.sting.gatk.walkers.bqsr.BaseRecalibrator.map(BaseRecalibrator.java:132) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano$TraverseReadsMap.apply(TraverseReadsNano.java:228) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano$TraverseReadsMap.apply(TraverseReadsNano.java:216) at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler.executeSingleThreaded(NanoScheduler.java:274) at org.broadinstitute.sting.utils.nanoScheduler.NanoScheduler.execute(NanoScheduler.java:245) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano.traverse(TraverseReadsNano.java:102) at org.broadinstitute.sting.gatk.traversals.TraverseReadsNano.traverse(TraverseReadsNano.java:56) at org.broadinstitute.sting.gatk.executive.LinearMicroScheduler.execute(LinearMicroScheduler.java:108) at org.broadinstitute.sting.gatk.GenomeAnalysisEngine.execute(GenomeAnalysisEngine.java:313) at org.broadinstitute.sting.gatk.CommandLineExecutable.execute(CommandLineExecutable.java:113) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245) at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152) at org.broadinstitute.sting.gatk.CommandLineGATK.main(CommandLineGATK.java:91)

ERROR ------------------------------------------------------------------------------------------
ERROR A GATK RUNTIME ERROR has occurred (version 2.8-1-g932cd3a):
ERROR
ERROR This might be a bug. Please check the documentation guide to see if this is a known problem.
ERROR If not, please post the error message, with stack trace, to the GATK forum.
ERROR Visit our website and forum for extensive documentation and answers to
ERROR commonly asked questions http://www.broadinstitute.org/gatk
ERROR
ERROR MESSAGE: START (90) > (89) STOP -- this should never happen, please check read: FCD1P68ACXX:7:1315:19572:52424#CGCGGTGA 1/2 90b aligned read. (CIGAR: 85M4I1M2D)

can you help me in this error message? Why its coming and how to rectify it? Thanks in advance Mayukh


Created 2013-07-31 19:20:30 | Updated 2013-07-31 19:20:55 | Tags: snpeff snp bwa substitution

Comments (1)

I have the genomes of several isolates of a parasite, and I would like to investigate synonymous/non-synonymous substitution for identifying potential antigens, as well as SNPs genome-wide and I am wondering how well BWA/GATK are suited for this purpose. I've been told that BWA is only very good with sequences <2% divergent, and some of the antigens in this specie are known to be >20% divergent. However, I also know that GATK does local realignments of indels. So I would specifically like to know - is BWA/GATK good for looking at substitutions/SNPs in highly variable genes, and if not which other alignment tools are compatible and appropriate for this purpose?


Created 2012-10-22 08:23:25 | Updated 2013-01-07 20:12:22 | Tags: realignertargetcreator bwa realignment

Comments (1)

Hello,

before I only used BWA and as you described in the best pratice I performed the realign step. Now I want to integrate in my pipeline Stampy associated with BWA.

Do you think, I should make the realign step ?

Thanks !


Created 2012-09-12 15:14:41 | Updated 2013-01-07 20:40:49 | Tags: bwa picard mtdna

Comments (1)

Picard appears not to like the way BWA codes mtDNA. I am doing human exome sequencing using a copy of hg19 which I obtained from UCSC and indexed using BWA per the instructions here:

Example 1

[Tue Aug 28 12:45:16 EDT 2012] net.sf.picard.sam.SortSam done. Elapsed time: 0.01 minutes.
Runtime.totalMemory()=125435904
FAQ: http://sourceforge.net/apps/mediawiki/picard/index.php?title=Main_Page
Exception in thread "main" net.sf.samtools.SAMFormatException: Error parsing text SAM file. Non-numeric value in ISIZE column; Line 3982
Line: FCC0CHTACXX:1:1101:14789:3170#TAGCTTAT 117 chrM 304415842 0 100M = -1610645157 2379906297 TGCGACTTGGAAGCGGATTCAGAGGACAGGACAGAACACTTGGGCAAGTGAATCTCTGTCTGTCTGTCTGTCTCATTGGTTGGTTTATTTCCATTTTCTT B@<:>CDDDBDDBDEEEEEEFEFCCHHFHHGGIIIHIGJJJIIGGGIIIIJJJIIGJIJGG@CEIFJIJJJJIJIJIJJJJIJJJGIHHGHFFEFFFCCC RG:Z:1868 XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:2 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:39G45G14 XA:Z:chrM,-391302964,100M,2;
at net.sf.samtools.SAMTextReader.reportFatalErrorParsingLine(SAMTextReader.java:223)
at net.sf.samtools.SAMTextReader.access$400(SAMTextReader.java:40)
at net.sf.samtools.SAMTextReader$RecordIterator.parseInt(SAMTextReader.java:293)
at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:394)
at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:278)
at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:250)
at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:641)
at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:619)
at net.sf.picard.sam.SortSam.doWork(SortSam.java:68)
at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
at net.sf.picard.cmdline.CommandLineProgram.instanceMainWithExit(CommandLineProgram.java:119)
at net.sf.picard.sam.SortSam.main(SortSam.java:57)

Example 2

java -jar ~/bin/picard-tools-1.74/MarkDuplicates.jar \
INPUT=1sorted.bam \
OUTPUT=1dedup.bam \
ASSUME_SORTED=true \
METRICS_FILE=metrics \
CREATE_INDEX=true \
VALIDATION_STRINGENCY=LENIENT

...
Ignoring SAM validation error: ERROR: Record 691, Read name FCC0CHTACXX:1:1302:4748:176644#GGCTACAT, Mate Alignment start (436154938) must be <= reference sequence length (16571) on reference chrM
Ignoring SAM validation error: ERROR: Record 692, Read name FCC0CHTACXX:1:2104:8494:167812#GGCTACAT, Mate Alignment start should != 0 because reference name != *.
Ignoring SAM validation error: ERROR: Record 693, Read name FCC0CHTACXX:1:1201:21002:183608#GGCTACAT, Mate Alignment start should != 0 because reference name != *.
Ignoring SAM validation error: ERROR: Record 694, Read name FCC0CHTACXX:1:2303:3184:35872#GGCTACAT, Mate Alignment start (436154812) must be <= reference sequence length (16571) on reference chrM
...

I've truncated the output; in fact it throws such an error for every single line of mitochondrial reads.

I suspect I could solve this by writing my own script to go in and change the way one column is coded, but more broadly, I am interested in the answer to "how do you make BWA, Picard and GATK work seamlessly together without needing to do your own scripting"?