Tagged with #breakend
0 documentation articles | 0 announcements | 1 forum discussion

No posts found with the requested search criteria.
No posts found with the requested search criteria.

Created 2013-10-24 15:22:35 | Updated | Tags: vcfcodec tribble bug strelka breakend
Comments (7)

I'm running into a problem with vcfs that have single ended break ends. (These are produced by an old version of Strelka .) Tribble doesn't recognize "." as valid in alternative alleles.

Single break ends are valid in the vcf standard and the files validate according to Vcftools.

Others have run into this problem as well: https://groups.google.com/forum/#!searchin/strelka-discuss/gatk/strelka-discuss/gJfsyjZNZXA/ExDXZiVWW_kJ

example error

##### ERROR stack trace
org.broad.tribble.TribbleException: The provided VCF file is malformed at approximately line number 1807: Unparsable vcf record with allele .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC, for input source: /cga/tcga-gsc/benchmark/Indels/strelkaPON/NA18606.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam-NA18608.mapped.ILLUMINA.bwa.CHB.exome.20111114.bam/final.indels.vcf
at org.broadinstitute.variant.vcf.AbstractVCFCodec.generateException(AbstractVCFCodec.java:715)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.checkAllele(AbstractVCFCodec.java:527)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseSingleAltAllele(AbstractVCFCodec.java:553)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseAlleles(AbstractVCFCodec.java:494)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.parseVCFLine(AbstractVCFCodec.java:291)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decodeLine(AbstractVCFCodec.java:234)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:213)
at org.broadinstitute.variant.vcf.AbstractVCFCodec.decode(AbstractVCFCodec.java:45)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:73)
at org.broad.tribble.AsciiFeatureCodec.decode(AsciiFeatureCodec.java:35)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.readNextRecord(TribbleIndexedFeatureReader.java:284)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:264)
at org.broad.tribble.TribbleIndexedFeatureReader$WFIterator.next(TribbleIndexedFeatureReader.java:225)
at org.broadinstitute.sting.tools.CatVariants.execute(CatVariants.java:239)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:245)
at org.broadinstitute.sting.commandline.CommandLineProgram.start(CommandLineProgram.java:152)
at org.broadinstitute.sting.tools.CatVariants.main(CatVariants.java:258)
##### ERROR ------------------------------------------------------------------------------------------

Example vcf line

19  36002413    .   C   .CCCAGGAGGACTCACTGCCGCTGTCACCTCTGCTGCCACCACTGTTGCCAC    .   PASS    IHP=1;NT=ref;QSI=82;QSI_NT=82;SGT=ref->hom;SOMATIC;SVTYPE=BND;TQSI=1;TQSI_NT=1  DP:DP2:TAR:TIR:TOR:DP50:FDP50:SUBDP50   49:49:42,44:0,0:7,6:43.72:0.85:0.00 11:11:0,0:6,6:5,5:14.61:0.48:0.0

A full vcf is available at: /humgen/gsa-scr1/pub/incoming/BreakendBug/breakend.vcf