| Genome | Sequence | Log-odds score | Z-score | Genome browser |
| hg17 | TTCAGCACCACGGACAGTGCTG | 30.90 | 6.60 | chr5:1300158-1300179 |
| canFam1 | TTCAGCACCCTGGACAGTGCT | 28.37 | 6.29 | chr34:14246646-14246666 |
| Distance | Gene | Description |
| 21689 | SLC6A18 | solute carrier family 6, member 18 |
| 45393 | SLC6A19 | solute carrier family 6 (neutral amino acid |
| 45449 | AK096054 | Hypothetical protein FLJ34635. |
| 47925 | AB085628 | Beta and gamma deletion isoform of telomerase reverse transcriptase. |
| 47980 | TERT | telomerase reverse transcriptase isoform 2 |
| 74266 | AK126225 | Hypothetical protein FLJ32533. |
| 97823 | BC025305 | Cisplatin resistance related protein CRR9p. |
| 97823 | CRR9 | cisplatin resistance related protein CRR9p |