| Genome | Sequence | Log-odds score | Z-score | Genome browser |
| hg17 | TTCAGAACCAAGGCCACCTTGG | 12.05 | 4.77 | chr4:8205631-8205652 |
| canFam1 | TTCAGAACAAAGGCCACCTCCT | 12.21 | 4.74 | chr3:62894367-62894388 |
| Distance | Gene | Description |
| -13868 | AK094798 | Splice isoform 4 of Q6H8Q1 |
| 72900 | AJ748601 | Actin-binding LIM protein 2 (Actin-binding LIM protein family member 2) (abLIM2). |
| 72900 | AJ748600 | Splice isoform 2 of Q6H8Q1 |
| 72940 | AK130044 | Hypothetical protein FLJ26534. |
| 72957 | AK094754 | Splice isoform 3 of Q6H8Q1 |
| 72957 | ABLIM2 | actin binding LIM protein family, member 2 |
| 72978 | BC067214 | Splice isoform 6 of Q6H8Q1 |