| Genome | Sequence | Log-odds score | Z-score | Genome browser |
| hg17 | ACCAGCACCCCGACCAgcgccg | 15.33 | 5.09 | chr2:231728204-231728225 |
| mm5 | ACCAGCACTCCGACCAGCGCGG | 6.08 | 4.17 | chr1:85931839-85931860 |
| rn3 | ACCAGGACCCCGACCAGCGCGG | 8.28 | 4.38 | chr9:84973474-84973495 |
| canFam1 | ACCAGCACCCCGACCAgcgccg | 15.33 | 5.04 | chr25:46035671-46035692 |
| Distance | Gene | Description |
| -18909 | PSMD1 | proteasome 26S non-ATPase subunit 1 |
| 41847 | AY032925 | Testis spermatocyte apoptosis-related gene 1 protein (Testis and spermatogenesis cell related protein 1). |
| 41859 | SPATA3 | testis and spermatogenesis cell apoptosis |
| 87104 | HTR2B | 5-hydroxytryptamine (serotonin) receptor 2B |