| Genome | Sequence | Log-odds score | Z-score | Genome browser |
| hg17 | GTCAGAACCCAAGAGAAAAGCA | 5.88 | 4.18 | chr17:6862410-6862431 |
| mm5 | GTCAGAACCCAAGAGAAATGCT | 5.89 | 4.16 | chr11:69846928-69846949 |
| rn3 | GTCAGAACCCAAGAGAAATGCT | 5.89 | 4.15 | chr10:57087100-57087121 |
| canFam1 | GTCAGAACCCAAGAGAAAGCAA | 6.20 | 4.16 | chr5:35017682-35017703 |
| Distance | Gene | Description |
| -4682 | BCL6B | B-cell CLL/lymphoma 6, member B (zinc finger |
| 3563 | MGC49942 | hypothetical protein LOC124944 |
| 5722 | MGC71993 | hypothetical protein LOC440400 |
| 5733 | CR600192 | Hypothetical protein MGC49942 (MGC71993 protein). |
| 22283 | ALOX12 | arachidonate 12-lipoxygenase |
| 25535 | SLC16A11 | solute carrier family 16, member 11 |
| 61840 | BC027858 | Splice isoform 3 of Q8IUN9 |
| 61842 | CR620226 | Splice isoform 2 of Q8IUN9 |
| 61893 | CLEC10A | C-type lectin, superfamily member 14 isoform 2 |
| 95852 | ASGR2 | asialoglycoprotein receptor 2 |