| Genome | Sequence | Log-odds score | Z-score | Genome browser |
| hg17 | TTCAGCAAAGAAGACAGGTATA | 7.89 | 4.37 | chr11:1425653-1425674 |
| mm5 | TTCAGCAAAGAAGACAGGTATA | 7.67 | 4.33 | chr7:129694945-129694966 |
| rn3 | TTCAGCAAAGAAGACAGGTATA | 7.67 | 4.32 | chr1:202281317-202281338 |
| canFam1 | TTCAGCAAAGAAGACAGGTATA | 7.89 | 4.32 | chr18:56029818-56029839 |
| Distance | Gene | Description |
| -5990 | AK123356 | Hypothetical protein FLJ41362. |
| 25588 | BX537373 | Hypothetical protein DKFZp779A0512. |
| 36696 | BRSK2 | BR serine/threonine kinase 2 |
| 57563 | AY505125 | Splice isoform 2 of Q8IWQ3 |
| 57947 | AF533880 | Splice isoform 2 of Q8IWQ3 |
| 57947 | AF533879 | BR serine/threonine-protein kinase 2 (EC 2.7.1.37) (Serine/threonine- protein kinase 29) (HUSSY-12). |