Transcript: lacZ.1

Identifier:
NCBI lacZ.1
Name:
(n/a)
Description:
ecoli lacZ NC_004431:448924..451998 ncbiGeneId: 1036228
Gene:
NCBI lacZ
Taxon:
CONTROL
Length:
3074
CDS Start:
0
CDS End:
3073

Hairpins designed to target this transcript.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000072223 TGTTCGCATTATCCGAACCAT CONTROL -15 lacZ pLKO.1 1168 CDS 100% 100% 0.300 N/A
2 TRCN0000072224 CGCGATCGTAATCACCCGAGT CONTROL -15 lacZ pLKO.1 1339 CDS 100% 100% 0.720 N/A
3 TRCN0000072225 CTCTGGCTAACGGTACGCGTA CONTROL -15 lacZ pLKO.1 2083 CDS 100% 100% 0.720 N/A
4 TRCN0000072226 CGATCGTAATCACCCGAGTGT CONTROL -15 lacZ pLKO.1 1341 CDS 100% 100% 2.640 N/A
5 TRCN0000072227 GCGCTAATCACGACGCGCTGT CONTROL -15 lacZ pLKO.1 1397 CDS 100% 100% 0.000 N/A
6 TRCN0000072228 ACTCTGGCTAACGGTACGCGT CONTROL -15 lacZ pLKO.1 2082 CDS 100% 100% 0.220 N/A
7 TRCN0000072229 GCGATCGTAATCACCCGAGTG CONTROL -15 lacZ pLKO.1 1340 CDS 100% 100% 0.750 N/A
8 TRCN0000072230 CCCGTCAGTATCGGCGGAATT CONTROL -15 lacZ pLKO.1 3003 CDS 100% 100% 0.000 N/A
9 TRCN0000072231 CGCTAAATACTGGCAGGCGTT CONTROL -15 lacZ pLKO.1 1650 CDS 100% 100% 2.160 N/A
10 TRCN0000072232 CGTCGTATTACAACGTCGTGA CONTROL -15 lacZ pLKO.1 27 CDS 100% 100% 2.640 N/A
11 TRCN0000072233 CGACCACGCAAATCAGCGATT CONTROL -15 lacZ pLKO.1 656 CDS 100% 100% 4.050 N/A
12 TRCN0000072234 CGGATTCTCTGGCCGTCGTAT CONTROL -15 lacZ pLKO.1 14 CDS 100% 100% 1.650 N/A
13 TRCN0000072235 CCGTCATAGCGATAACGAGTT CONTROL -15 lacZ pLKO.1 1935 CDS 100% 100% 4.050 N/A
14 TRCN0000072236 CCAACGTGACCTATCCCATTA CONTROL -15 lacZ pLKO.1 305 CDS 100% 100% 10.800 N/A
15 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT CONTROL -15 lacZ pLKO.1 816 CDS 100% 100% 0.000 N/A
16 TRCN0000072238 GTTCCGTCATAGCGATAACGA CONTROL -15 lacZ pLKO.1 1932 CDS 100% 100% 3.000 N/A
17 TRCN0000072239 GCCGTCGTATTACAACGTCGT CONTROL -15 lacZ pLKO.1 25 CDS 100% 100% 2.160 N/A
18 TRCN0000072240 TCGTATTACAACGTCGTGACT CONTROL -15 lacZ pLKO.1 29 CDS 100% 100% 2.640 N/A
19 TRCN0000072241 GCGTTGGCAATTTAACCGCCA CONTROL -15 lacZ pLKO.1 2265 CDS 100% 100% 0.540 N/A
20 TRCN0000072242 GTCGGCTTACGGCGGTGATTT CONTROL -15 lacZ pLKO.1 1758 CDS 100% 100% 4.400 N/A
21 TRCN0000231726 TGTTCGCATTATCCGAACCAT CONTROL -15 lacZ pLKO_TRC005 1168 CDS 100% 100% 0.300 N/A
22 TRCN0000231722 CGCGATCGTAATCACCCGAGT CONTROL -15 lacZ pLKO_TRC005 1339 CDS 100% 100% 0.720 N/A
23 TRCN0000231709 CGATCGTAATCACCCGAGTGT CONTROL -15 lacZ pLKO_TRC005 1341 CDS 100% 100% 2.640 N/A
24 TRCN0000231708 GCGCTAATCACGACGCGCTGT CONTROL -15 lacZ pLKO_TRC005 1397 CDS 100% 100% 0.000 N/A
25 TRCN0000231713 ACTCTGGCTAACGGTACGCGT CONTROL -15 lacZ pLKO_TRC005 2082 CDS 100% 100% 0.220 N/A
26 TRCN0000231712 GCGATCGTAATCACCCGAGTG CONTROL -15 lacZ pLKO_TRC005 1340 CDS 100% 100% 0.750 N/A
27 TRCN0000231711 CCCGTCAGTATCGGCGGAATT CONTROL -15 lacZ pLKO_TRC005 3003 CDS 100% 100% 0.000 N/A
28 TRCN0000231710 CGCTAAATACTGGCAGGCGTT CONTROL -15 lacZ pLKO_TRC005 1650 CDS 100% 100% 2.160 N/A
29 TRCN0000231717 CGTCGTATTACAACGTCGTGA CONTROL -15 lacZ pLKO_TRC005 27 CDS 100% 100% 2.640 N/A
30 TRCN0000231716 CGACCACGCAAATCAGCGATT CONTROL -15 lacZ pLKO_TRC005 656 CDS 100% 100% 4.050 N/A
31 TRCN0000231738 CCGTCATAGCGATAACGAGTT CONTROL -15 lacZ pLKO_TRC005 1935 CDS 100% 100% 4.050 N/A
32 TRCN0000231735 CCAACGTGACCTATCCCATTA CONTROL -15 lacZ pLKO_TRC005 305 CDS 100% 100% 10.800 N/A
33 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT CONTROL -15 lacZ pLKO_TRC005 816 CDS 100% 100% 0.000 N/A
34 TRCN0000231685 GTTCCGTCATAGCGATAACGA CONTROL -15 lacZ pLKO_TRC005 1932 CDS 100% 100% 3.000 N/A
35 TRCN0000231700 GCCGTCGTATTACAACGTCGT CONTROL -15 lacZ pLKO_TRC005 25 CDS 100% 100% 2.160 N/A
36 TRCN0000231702 TCGTATTACAACGTCGTGACT CONTROL -15 lacZ pLKO_TRC005 29 CDS 100% 100% 2.640 N/A
37 TRCN0000231704 GCGTTGGCAATTTAACCGCCA CONTROL -15 lacZ pLKO_TRC005 2265 CDS 100% 100% 0.540 N/A
38 TRCN0000231706 GTCGGCTTACGGCGGTGATTT CONTROL -15 lacZ pLKO_TRC005 1758 CDS 100% 100% 4.400 N/A
Download CSV

All "non-targeting" hairpins matching this transcript

This list includes shRNAs that perfectly or closely match the queried transcript, but that were originally designed to target something other than the queried transcript. For example, this list can include shRNAs that were originally designed to target: (i) different isoforms or obsolete versions of the queried transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000072201 GTCGAGCTGGACGGCGACGTA CONTROL -10 GFP pLKO.1 49 CDS 73% 80% N/A N/A
2 TRCN0000063939 CCGCTGGATCTGCCACTGTTT human 9253 NUMBL pLKO.1 710 CDS 81% 90% N/A N/A
3 TRCN0000034888 CAGGCAGAGGTTCAGATGTAT human 79709 GLT25D1 pLKO.1 835 CDS 85% 89% N/A N/A
4 TRCN0000056879 CGGCTTGCTTTCACAGATGTT human 4599 MX1 pLKO.1 1786 CDS 85% 89% N/A N/A
5 TRCN0000013367 GCGCTGAATTGCATTATGGAA human 9139 CBFA2T2 pLKO.1 1582 CDS 80% 89% N/A N/A
6 TRCN0000046251 GTGGATGAAGATCCAACCCAA human 2879 GPX4 pLKO.1 515 CDS 80% 89% N/A N/A
7 TRCN0000229689 ACAGGTTGTTACTCGATTATT human 7728 ZNF175 pLKO_TRC005 2826 3UTR 80% 89% N/A N/A
8 TRCN0000300410 GTGGATGAAGATCCAACCCAA human 2879 GPX4 pLKO_TRC005 542 CDS 80% 89% N/A N/A
9 TRCN0000014093 GCTGTTTGTTCCTGGGAGAAT human 5540 PPYR1 pLKO.1 1391 3UTR 86% 85% N/A N/A
10 TRCN0000057086 GCGTGGAGATGACCACGCCCT human 3543 IGLL1 pLKO.1 594 CDS 86% 85% N/A N/A
11 TRCN0000059049 GCTGGATAAAGACCACGCAAA human 9788 MTSS1 pLKO.1 826 CDS 86% 85% N/A N/A
12 TRCN0000073007 CAGTATATCAGTTCCAGTTTA human 8498 RANBP3 pLKO.1 906 CDS 86% 85% N/A N/A
13 TRCN0000155936 CTTGCTGGATGAGCAGAACAA human 55954 ZMAT5 pLKO.1 277 CDS 86% 85% N/A N/A
14 TRCN0000172611 GCAGAAGAAGACAATGGCTGA human 79140 CCDC28B pLKO.1 577 CDS 86% 85% N/A N/A
15 TRCN0000319227 CTTGCTGGATGAGCAGAACAA human 55954 ZMAT5 pLKO_TRC005 277 CDS 86% 85% N/A N/A
16 TRCN0000428674 CCGAAAGGTAGCAGCTGATTG human 752 FMNL1 pLKO_TRC005 491 CDS 86% 85% N/A N/A
17 TRCN0000038597 GAGGCTTCTCTCACAGATGTT human 162515 SLC16A11 pLKO.1 370 CDS 81% 85% N/A N/A
18 TRCN0000045809 GCTAGATCCAAATCTTCGATA human 9791 PTDSS1 pLKO.1 498 CDS 81% 85% N/A N/A
19 TRCN0000107216 CGCCGTGAAAGCTGGTGGAAT human 1611 DAP pLKO.1 210 CDS 81% 85% N/A N/A
20 TRCN0000156104 CCAACTTAATGGCTTGCAGTA human 10282 BET1 pLKO.1 549 3UTR 81% 85% N/A N/A
21 TRCN0000158349 CGGCAGCTGATGTGAAGAATA human 65082 VPS33A pLKO.1 277 CDS 81% 85% N/A N/A
22 TRCN0000153991 CATGGCAGATTACATTGCCAA human 84159 ARID5B pLKO.1 1880 CDS 81% 85% N/A N/A
23 TRCN0000245500 CCGCGTACACCTACAACAACA human 3483 IGFALS pLKO_TRC005 1777 CDS 81% 85% N/A N/A
24 TRCN0000338732 AGCGGACTTTCCGTGACATTT human 23731 TMEM245 pLKO_TRC005 2623 CDS 81% 85% N/A N/A
25 TRCN0000290942 GCTAGATCCAAATCTTCGATA human 9791 PTDSS1 pLKO_TRC005 498 CDS 81% 85% N/A N/A
26 TRCN0000417704 GGTGGTTAAAGCCATATTGGA human 8926 SNURF pLKO_TRC005 334 CDS 81% 85% N/A N/A
27 TRCN0000424848 GCCAGGGTCGAATCTGGAATG human 60598 KCNK15 pLKO_TRC005 1071 3UTR 81% 85% N/A N/A
28 TRCN0000002585 CGGGTCAACTGCTCGGTCTAT human 8612 PPAP2C pLKO.1 508 CDS 77% 85% N/A N/A
29 TRCN0000061484 CGATGTACTCACGCTGGATAT human 9244 CRLF1 pLKO.1 869 CDS 77% 85% N/A N/A
30 TRCN0000138007 GAGATGTGTTTGGCGATGAGT human 81563 C1orf21 pLKO.1 548 CDS 77% 85% N/A N/A
31 TRCN0000136987 CTTGAGAAAGATGGCTACACA human 389383 CLPSL2 pLKO.1 231 CDS 77% 85% N/A N/A
32 TRCN0000139061 CAGGACTATGTGCAGATGAAG human 797 CALCB pLKO.1 236 CDS 77% 85% N/A N/A
33 TRCN0000163605 CCTGAATCTCATCCTGCAGAA human 23313 KIAA0930 pLKO.1 453 CDS 77% 85% N/A N/A
34 TRCN0000139358 CAGTTGATGAGCTGCTTGAGA human 400934 FLJ44385 pLKO.1 1529 CDS 77% 85% N/A N/A
35 TRCN0000246278 CTGCTGATGAGAAGTACAAAC human 388389 CCDC103 pLKO_TRC005 145 CDS 77% 85% N/A N/A
36 TRCN0000299639 CGATGTACTCACGCTGGATAT human 9244 CRLF1 pLKO_TRC005 860 CDS 77% 85% N/A N/A
37 TRCN0000436537 CAATTATCGATGGCGTTGCAA human 6037 RNASE3 pLKO_TRC005 228 CDS 77% 85% N/A N/A
38 TRCN0000440976 GAGATGATCGATGAGGTGGAC human 7134 TNNC1 pLKO_TRC005 201 CDS 77% 85% N/A N/A
39 TRCN0000106981 CTACCATTCCAGCGTCTGGTA human 8968 HIST1H3F pLKO.1 198 CDS 79% 81% N/A N/A
40 TRCN0000063647 CCGCATCACACGCATCCTCAA human 11054 OGFR pLKO.1 668 CDS 82% 80% N/A N/A
41 TRCN0000275801 GCCTTCTCTGGCCTCTATTAC human 9842 PLEKHM1 pLKO_TRC005 2679 CDS 82% 80% N/A N/A
42 TRCN0000004606 ATGGCTTACCTGTCGGAGAAT human 64344 HIF3A pLKO.1 403 CDS 78% 80% N/A N/A
43 TRCN0000017065 CGACCGCTTACGCAGGGTGGT human 220202 ATOH7 pLKO.1 601 CDS 78% 80% N/A N/A
44 TRCN0000038615 GAAGAAGCTCAGGCTGAAATT human 9550 ATP6V1G1 pLKO.1 205 CDS 78% 80% N/A N/A
45 TRCN0000083640 CGTTACCATTGGCTGGTCTTA human 54840 APTX pLKO.1 677 CDS 78% 80% N/A N/A
46 TRCN0000135792 CCTGGTGAGAAGAGAACATTT human 79608 RIC3 pLKO.1 1601 3UTR 78% 80% N/A N/A
47 TRCN0000129528 GCCATCTTGCACTCAGAAGAT human 119032 C10orf32 pLKO.1 213 CDS 78% 80% N/A N/A
48 TRCN0000129915 GCAAGCTAAGCAAGATTGAAT human 55704 CCDC88A pLKO.1 2550 CDS 78% 80% N/A N/A
49 TRCN0000152708 GTATTATGAGAGCGGCTACAA human 119180 LYZL2 pLKO.1 283 CDS 78% 80% N/A N/A
50 TRCN0000273315 ATGTGGGATGAGACGGAATTG human 29128 UHRF1 pLKO_TRC005 708 CDS 78% 80% N/A N/A
51 TRCN0000327872 GAAGAAGCTCAGGCTGAAATT human 9550 ATP6V1G1 pLKO_TRC005 237 CDS 78% 80% N/A N/A
52 TRCN0000058990 CCAACAGACAAGATGGAAGAA human 163702 IL28RA pLKO.1 952 CDS 73% 80% N/A N/A
53 TRCN0000063752 GCTGCGGAAGAAGAGGCCATA human 2055 CLN8 pLKO.1 1074 CDS 73% 80% N/A N/A
54 TRCN0000127884 GATCAGCCTACAGCCAAGATA human 399886 FLJ41423 pLKO.1 2019 CDS 73% 80% N/A N/A
55 TRCN0000142646 GCTGGAATCCTCTTCCTGAAA human 29075 HSPC072 pLKO.1 567 CDS 73% 80% N/A N/A
56 TRCN0000195604 CAGTACCAGTGTTTGGTGTTT human 558 AXL pLKO.1 798 CDS 73% 80% N/A N/A
57 TRCN0000239339 ATGGCATCAAGTGCAAGTTCT human 340152 ZC3H12D pLKO_TRC005 955 CDS 73% 80% N/A N/A
58 TRCN0000282829 CCAAGAAGGCACATCTGAAAC human 143379 C10orf82 pLKO_TRC005 486 CDS 73% 80% N/A N/A
59 TRCN0000355671 TGGCTTACCTGTCGGAGAATG human 64344 HIF3A pLKO_TRC005 404 CDS 73% 80% N/A N/A
60 TRCN0000369881 GACTCTCTAAATGTGATTTAT human 5912 RAP2B pLKO_TRC005 1058 3UTR 73% 80% N/A N/A
61 TRCN0000431836 ACCGGAAGCAAAGTCAGATTC human 3978 LIG1 pLKO_TRC005 2810 CDS 73% 80% N/A N/A
62 TRCN0000257998 AGCAGTGATTCTGACTGAATA human 54458 PRR13 pLKO_TRC005 594 CDS 72% 78% N/A N/A
63 TRCN0000158264 CCTGCTGGAAGACAAGAACTT human 255101 CCDC108 pLKO.1 2956 CDS 79% 77% N/A N/A
64 TRCN0000373067 TGAGCTGAAGAGTGAGGATAT human 4340 MOG pLKO_TRC005 1168 3UTR 79% 77% N/A N/A
65 TRCN0000037450 CGGAACATTGTTCATCGTGAT human 23387 SIK3 pLKO.1 406 CDS 75% 77% N/A N/A
66 TRCN0000061987 CAAATGGATGAAATACGGTTA human 946 SIGLEC6 pLKO.1 537 CDS 75% 77% N/A N/A
67 TRCN0000155722 CGATACACAGAATCGCCAGAT human 6616 SNAP25 pLKO.1 725 CDS 75% 77% N/A N/A
68 TRCN0000204211 CATGGTGGTATGGCTGAACAA human 51537 MTFP1 pLKO.1 1111 3UTR 75% 77% N/A N/A
69 TRCN0000242115 CCCAATATCGCAGACCGATTA human 284615 ANKRD34A pLKO_TRC005 1501 CDS 75% 77% N/A N/A
70 TRCN0000298760 CGGAACATTGTTCATCGTGAT human 23387 SIK3 pLKO_TRC005 406 CDS 75% 77% N/A N/A
71 TRCN0000343625 CGATACACAGAATCGCCAGAT human 6616 SNAP25 pLKO_TRC005 725 CDS 75% 77% N/A N/A
72 TRCN0000128593 GCGGAAATTTATTGCATCCTT human 196441 ZFC3H1 pLKO.1 5288 CDS 70% 77% N/A N/A
73 TRCN0000157720 CGGAGATTCCAGGTTGTTGTA human 253738 EBF3 pLKO.1 684 CDS 70% 77% N/A N/A
74 TRCN0000141887 GATGAATGACTCCAGGAAGAA human 797 CALCB pLKO.1 461 3UTR 70% 77% N/A N/A
75 TRCN0000165969 GCAACTGAGAAACAGCCAGAT human 440313 LOC440313 pLKO.1 2836 3UTR 70% 77% N/A N/A
76 TRCN0000142526 GTTCTGAAGAACTCTGGCCAA human 257000 PLAC2 pLKO.1 1158 3UTR 70% 77% N/A N/A
77 TRCN0000234798 AGATGTGGTTCGATGACAATA human 10867 TSPAN9 pLKO_TRC005 731 CDS 70% 77% N/A N/A
78 TRCN0000036702 TCTGGGAAACTGGCGTGACAA human 401897 LOC401897 pLKO.1 375 CDS 70% 77% N/A N/A
79 TRCN0000008642 CCTTGCCCGCTCGGGTATGAA human 6208 RPS14 pLKO.1 410 CDS 76% 73% N/A N/A
80 TRCN0000277903 CCTTGCCCGCTCGGGTATGAA human 6208 RPS14 pLKO_TRC005 410 CDS 76% 73% N/A N/A
81 TRCN0000418344 CACACACCACCACCGTATTAT human 222484 LNX2 pLKO_TRC005 1636 CDS 76% 73% N/A N/A
82 TRCN0000052698 GCCATGTCAGTTTATACCTTA human 51205 ACP6 pLKO.1 1645 CDS 68% 73% N/A N/A
83 TRCN0000121821 GATGAAGACAACTTGAACTAT human 139425 DCAF8L1 pLKO.1 1712 CDS 68% 73% N/A N/A
84 TRCN0000289154 GCCATGTCAGTTTATACCTTA human 51205 ACP6 pLKO_TRC005 1665 CDS 68% 73% N/A N/A
85 TRCN0000027859 CGACTTCCTGTTCAACATCTT mouse 14747 Cmklr1 pLKO.1 510 CDS 85% 94% N/A N/A
86 TRCN0000322397 AGATGTGGATGGCGAGAAATA mouse 66230 Mrps28 pLKO_TRC005 405 CDS 86% 90% N/A N/A
87 TRCN0000023297 CGCTGCCAAGACGGTGAAGTT mouse 14182 Fgfr1 pLKO.1 564 CDS 85% 89% N/A N/A
88 TRCN0000102994 GTCTGTCTACACCAACGTGAT mouse 108015 Chrnb4 pLKO.1 412 CDS 85% 89% N/A N/A
89 TRCN0000177033 GAACAACTGAAGGAAACCAAA mouse 66396 Ccdc82 pLKO.1 372 CDS 80% 89% N/A N/A
90 TRCN0000279512 GAGCAGCCGGACAACTCTAAT mouse 64209 Herpud1 pLKO_TRC005 408 CDS 80% 89% N/A N/A
91 TRCN0000336293 GAACAACTGAAGGAAACCAAA mouse 66396 Ccdc82 pLKO_TRC005 472 CDS 80% 89% N/A N/A
92 TRCN0000305052 GGCATGGAGAGATGGTCATTT mouse 14313 Fst pLKO_TRC005 1409 3UTR 80% 89% N/A N/A
93 TRCN0000374404 CGCTGTACTCTGGAGCAAATC mouse 232944 Mark4 pLKO_TRC005 892 CDS 86% 85% N/A N/A
94 TRCN0000026093 GCTGTGTCGTCTGGTCAAATA mouse 18430 Oxtr pLKO.1 330 CDS 81% 85% N/A N/A
95 TRCN0000090309 CCAACAATCATACTATGGAAT mouse 72780 Rspo3 pLKO.1 890 CDS 81% 85% N/A N/A
96 TRCN0000098926 GCCAACAACAATGCTGGTAAT mouse 229584 Pogz pLKO.1 301 CDS 81% 85% N/A N/A
97 TRCN0000124665 GCTTCCTTTCAAGATCGTGGT mouse 18203 Ntan1 pLKO.1 651 CDS 81% 85% N/A N/A
98 TRCN0000193044 GACCATGTTACGGATTATCTA mouse 268933 Wdr24 pLKO.1 1848 CDS 81% 85% N/A N/A
99 TRCN0000251674 TACTAGCAGATGCAGGTTATG mouse 70166 Lipn pLKO_TRC005 553 CDS 81% 85% N/A N/A
100 TRCN0000312286 GCTTCCTTTCAAGATCGTGGT mouse 18203 Ntan1 pLKO_TRC005 653 CDS 81% 85% N/A N/A
101 TRCN0000031806 TGCCATGTCAGCCAGTATAAT mouse 16613 Klk1b11 pLKO.1 222 CDS 78% 85% N/A N/A
102 TRCN0000313550 AGAAGCCCGTCGTCGGTTTAA mouse 19155 Npepps pLKO_TRC005 2290 CDS 78% 85% N/A N/A
103 TRCN0000306390 TCTGGCTAGGTACAGCGTAAA mouse 68040 Zfp593 pLKO_TRC005 754 3UTR 78% 85% N/A N/A
104 TRCN0000089399 GCAGTGGTTGATGAACACCAA mouse 14526 Gcg pLKO.1 326 CDS 78% 85% N/A N/A
105 TRCN0000042714 GCAACAGAGTATATCCAGTAT mouse 17187 Max pLKO.1 359 CDS 77% 85% N/A N/A
106 TRCN0000098399 GTGTGATCATTGGTTGCAGCA mouse 70831 Krtap31-1 pLKO.1 449 CDS 77% 85% N/A N/A
107 TRCN0000126111 GCATCCGCCATTGTAGACAAT mouse 74775 Lmbr1l pLKO.1 692 CDS 77% 85% N/A N/A
108 TRCN0000179007 CGAAGGACATTGTTGCAGTAT mouse 225523 Cep120 pLKO.1 585 CDS 77% 85% N/A N/A
109 TRCN0000183635 GCTTTCCAAGTTCAACTCTAA mouse 223267 A2ld1 pLKO.1 620 3UTR 77% 85% N/A N/A
110 TRCN0000248466 ACCCGAGATGTATCATCTAAG mouse 57896 Krcc1 pLKO_TRC005 1070 CDS 77% 85% N/A N/A
111 TRCN0000315984 GCAACAGAGTATATCCAGTAT mouse 17187 Max pLKO_TRC005 422 CDS 77% 85% N/A N/A
112 TRCN0000376957 GAAGATGGTGCTGGTATCCAC mouse 170759 Atp13a1 pLKO_TRC005 3625 3UTR 77% 85% N/A N/A
113 TRCN0000041158 CCACTCTTAATGTGATTTCTT mouse 51902 Rnf24 pLKO.1 2782 3UTR 76% 82% N/A N/A
114 TRCN0000174001 CCACAATGATGAAAGCAGCCA mouse 18483 Palm pLKO.1 503 CDS 82% 80% N/A N/A
115 TRCN0000248480 ACCACCAGCTGAAGATCTTTG mouse 57315 Wdr46 pLKO_TRC005 1151 CDS 82% 80% N/A N/A
116 TRCN0000279373 TTCACCCATCACCGCTGATAA mouse 105203 BC016423 pLKO_TRC005 3565 CDS 82% 80% N/A N/A
117 TRCN0000328195 CATCAGGGAAGCCTTACTTAT mouse 113853 Vmn1r53 pLKO_TRC005 570 CDS 82% 80% N/A N/A
118 TRCN0000030801 GCATGGTACAAGATGGATGAT mouse 13532 Usp17l5 pLKO.1 974 CDS 78% 80% N/A N/A
119 TRCN0000221440 CCAAGGCATGTGCAACGAATA mouse 30800 Mmp20 pLKO.1 1181 CDS 78% 80% N/A N/A
120 TRCN0000039524 GCTCACTTAAGGTTGATGATA mouse 66743 Rnf220 pLKO.1 874 CDS 78% 80% N/A N/A
121 TRCN0000072176 CGCAAGAACCAGTTAATTGTA mouse 94043 Tm2d1 pLKO.1 206 CDS 78% 80% N/A N/A
122 TRCN0000077719 GCAGTTCATGTACGACGAGTT mouse 56044 Rala pLKO.1 333 CDS 78% 80% N/A N/A
123 TRCN0000182727 GCCATCTTACACTCGGAAGAT mouse 66439 2010012O05Rik pLKO.1 223 CDS 78% 80% N/A N/A
124 TRCN0000281839 TCTGATAAGCGACCAACTTAA mouse 80902 Zfp202 pLKO_TRC005 2475 3UTR 78% 80% N/A N/A
125 TRCN0000309185 CGCAAGAACCAGTTAATTGTA mouse 94043 Tm2d1 pLKO_TRC005 232 CDS 78% 80% N/A N/A
126 TRCN0000335365 GCAGTTCATGTACGACGAGTT mouse 56044 Rala pLKO_TRC005 333 CDS 78% 80% N/A N/A
127 TRCN0000366062 GACTGGAAACCCTGACTTTAT mouse 18746 Pkm2 pLKO_TRC005 1861 3UTR 78% 80% N/A N/A
128 TRCN0000375474 CGTCATGATAGGAGACGATTG mouse 76987 Hdhd2 pLKO_TRC005 678 CDS 78% 80% N/A N/A
129 TRCN0000114175 GCGAATCTGTTCCCTTATAAA mouse 67895 Ppa1 pLKO.1 352 CDS 73% 80% N/A N/A
130 TRCN0000179866 CCACAAGAAATATCCCGAGAA mouse 70208 Med23 pLKO.1 2833 CDS 73% 80% N/A N/A
131 TRCN0000238608 CCAACAGCAACTGGGAAATAT mouse 229571 Gm4858 pLKO_TRC005 953 3UTR 73% 80% N/A N/A
132 TRCN0000247394 TAGTCACCACTGTGATCATTG mouse 245532 Awat2 pLKO_TRC005 110 CDS 73% 80% N/A N/A
133 TRCN0000255213 TGAAGAGAACCTGCGACAATA mouse 627191 Tmem90a pLKO_TRC005 1144 3UTR 73% 80% N/A N/A
134 TRCN0000313993 ACGAAGAGGCCCACCGATTAT mouse 69072 Ebna1bp2 pLKO_TRC005 504 CDS 73% 80% N/A N/A
135 TRCN0000341854 CCACAAGAAATATCCCGAGAA mouse 70208 Med23 pLKO_TRC005 2833 CDS 73% 80% N/A N/A
136 TRCN0000309313 GCGAATCTGTTCCCTTATAAA mouse 67895 Ppa1 pLKO_TRC005 351 CDS 73% 80% N/A N/A
137 TRCN0000374301 TGGATAATCACAGGTTGTTTG mouse 12545 Cdc7 pLKO_TRC005 1930 3UTR 73% 80% N/A N/A
138 TRCN0000374759 TCATAGCATCACGGTTCATAT mouse 226525 Rasal2 pLKO_TRC005 1770 CDS 73% 80% N/A N/A
139 TRCN0000222640 GCCAGTCTGATGAAGGTTCAA mouse 26565 Pla2g10 pLKO.1 793 3UTR 73% 80% N/A N/A
140 TRCN0000075939 CCCTTCAACATTGCCAGCTAT mouse 22171 Tyms pLKO.1 687 CDS 72% 78% N/A N/A
141 TRCN0000317508 CCCTTCAACATTGCCAGCTAT mouse 22171 Tyms pLKO_TRC005 686 CDS 72% 78% N/A N/A
142 TRCN0000428449 ATCGTTCCCGGGAACAGTATG mouse 229004 Gmeb2 pLKO_TRC005 1042 CDS 79% 77% N/A N/A
143 TRCN0000093104 GCTGCTGGAAGAGAATAACTA mouse 76653 Cby3 pLKO.1 774 CDS 75% 77% N/A N/A
144 TRCN0000111370 AGCTGAAAGAAGCGTTGCTTA mouse 20022 Polr2j pLKO.1 372 3UTR 75% 77% N/A N/A
145 TRCN0000111587 CCAGTTCAAGATCGGTCTGAT mouse 56433 Vps29 pLKO.1 295 CDS 75% 77% N/A N/A
146 TRCN0000125686 CGGCCTGAAGCCCAGCTGGAA mouse 67676 Rpp21 pLKO.1 345 CDS 75% 77% N/A N/A
147 TRCN0000332516 AGCTGAAAGAAGCGTTGCTTA mouse 20022 Polr2j pLKO_TRC005 418 3UTR 75% 77% N/A N/A
148 TRCN0000097274 GCTGGGATGATCAAGCCATTT mouse 18783 Pla2g4a pLKO.1 2415 3UTR 70% 77% N/A N/A
149 TRCN0000102925 GCTGCCATTAGAGATGTATTT mouse 108043 Chrnb3 pLKO.1 1722 3UTR 70% 77% N/A N/A
150 TRCN0000104248 TGGTGCATCTCTTGCTGATAT mouse 68193 Rpl24 pLKO.1 291 CDS 70% 77% N/A N/A
151 TRCN0000111559 GCTGATGAACAGAGCCTTGTT mouse 65114 Vps35 pLKO.1 1518 CDS 70% 77% N/A N/A
152 TRCN0000193931 CCATCATCCTTATGGTCAGTA mouse 231549 Lrrc8d pLKO.1 925 CDS 70% 77% N/A N/A
153 TRCN0000318221 GCTGATGAACAGAGCCTTGTT mouse 65114 Vps35 pLKO_TRC005 1493 CDS 70% 77% N/A N/A
154 TRCN0000335307 GCTGGGATGATCAAGCCATTT mouse 18783 Pla2g4a pLKO_TRC005 2415 3UTR 70% 77% N/A N/A
155 TRCN0000435939 AGAACGGTGTGGTCATCAAAT mouse 13983 Esr2 pLKO_TRC005 2404 3UTR 70% 77% N/A N/A
156 TRCN0000248680 TGGGCACAGTGTGGATCAATG mouse 69748 Aldh16a1 pLKO_TRC005 1397 CDS 76% 75% N/A N/A
157 TRCN0000126101 CCTACAGGAAAGACGCAGAAT mouse 58866 Treh pLKO.1 880 CDS 76% 73% N/A N/A
158 TRCN0000366470 TGAACAGCAAGTCCGTGATTC mouse 18969 Pola2 pLKO_TRC005 1096 CDS 76% 73% N/A N/A
159 TRCN0000419127 TGCAGGAACAGACCCGATTAT mouse 104175 Sbk1 pLKO_TRC005 2195 3UTR 76% 73% N/A N/A
160 TRCN0000127431 CACCACACAATCAATTTCCAT mouse 231986 Jazf1 pLKO.1 699 CDS 72% 73% N/A N/A
161 TRCN0000267961 GACAGGAAAGAAGCGAATTAC mouse 68736 1110034B05Rik pLKO_TRC005 726 CDS 72% 73% N/A N/A
162 TRCN0000360375 CGCGGTGGAGACGAAGTTTAT mouse 18034 Nfkb2 pLKO_TRC005 994 CDS 72% 73% N/A N/A
163 TRCN0000420061 AGATCTGGTCAGAATGTATTG mouse 74245 Ctbs pLKO_TRC005 602 CDS 66% 72% N/A N/A
Download CSV

All hairpins matching this transcript

(this is the union of the above two tables, provided here as a single download link)

Download CSV

Hairpin Candidate Sequences

Show high scoring hairpin designs for this transcript.

ORFs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464771 pDONR223 0% 91.7% 92.2% None (many diffs)
2 ccsbBroad301_99994 pLX_TRC301 0% 91.7% 92.2% None (many diffs)
3 ccsbBroad301_99995 pLX_TRC301 0% 91.7% 92.2% None (many diffs)
4 ccsbBroad301_99996 pLX_TRC301 0% 91.7% 92.2% None (many diffs)
5 ccsbBroad301_99983 pLX_TRC301 0% 91.7% 92.2% None (many diffs)
6 ccsbBroad304_99994 pLX_TRC304 3.4% 91.7% 92.2% V5 (many diffs)
7 ccsbBroad304_99996 pLX_TRC304 3.4% 91.7% 92.2% V5 (many diffs)
8 ccsbBroad304_99995 pLX_TRC304 3.4% 91.7% 92.2% V5 (many diffs)
9 BRDN0000559441 pLX_TRC307 0% 91.7% 92.2% V5 (many diffs)
10 BRDN0000464780 pLX_TRC302 0% 91.7% 92.2% V5 (many diffs)
11 BRDN0000556272 pLX_TRC303 0% 91.7% 92.2% None (many diffs)
12 BRDN0000556278 pLX_TRC305 0% 91.7% 92.2% None (many diffs)
13 BRDN0000556288 pLX_TRC306 0% 91.7% 92.2% V5 (many diffs)
14 BRDN0000556266 pLXI_TRC401 0% 91.7% 92.2% None (many diffs)
15 BRDN0000556290 pLXI_TRC402 0% 91.7% 92.2% HA (many diffs)
16 BRDN0000556291 pLX_TRC311 0% 91.7% 92.2% V5 (many diffs)
17 BRDN0000556274 pLX_TRC312 0% 91.7% 92.2% V5 (many diffs)
18 BRDN0000556300 pLX_TRC313 0% 91.7% 92.2% V5 (many diffs)
19 BRDN0000556279 pLX_TRC314 0% 91.7% 92.2% V5 (many diffs)
20 BRDN0000556294 pLX_TRC315 0% 91.7% 92.2% V5 (many diffs)
21 BRDN0000556277 pLXI_TRC403 0% 91.7% 92.2% V5 (many diffs)
22 BRDN0000464772 pDONR223 0% 91.7% 92.2% None (many diffs)
23 BRDN0000464773 pDONR223 0% 91.7% 92.2% None (many diffs)
Download CSV