Transcript: clonetechGfp.1

clonetech clonetechGfp.1
clonetech GFP
Clontech GFP
CDS Start:
CDS End:

Hairpins designed to target this transcript.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000072178 CAACAGCCACAACGTCTATAT CONTROL -10 GFP pLKO.1 438 CDS 100% 100% 13.200 N/A
2 TRCN0000072179 CGACCACATGAAGCAGCACGA CONTROL -10 GFP pLKO.1 228 CDS 100% 100% 0.720 N/A
3 TRCN0000072180 CTATATCATGGCCGACAAGCA CONTROL -10 GFP pLKO.1 453 CDS 100% 100% 2.640 N/A
4 TRCN0000072181 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO.1 437 CDS 100% 100% 13.200 N/A
5 TRCN0000072182 TCTCGGCATGGACGAGCTGTA CONTROL -10 GFP pLKO.1 693 CDS 100% 100% 1.350 N/A
6 TRCN0000072183 CGGCATGGACGAGCTGTACAA CONTROL -10 GFP pLKO.1 696 CDS 100% 100% 1.650 N/A
7 TRCN0000072184 CGGGATCACTCTCGGCATGGA CONTROL -10 GFP pLKO.1 684 CDS 100% 100% 0.000 N/A
8 TRCN0000072185 TACAACAGCCACAACGTCTAT CONTROL -10 GFP pLKO.1 436 CDS 100% 100% 4.950 N/A
9 TRCN0000072186 TGCCCGACAACCACTACCTGA CONTROL -10 GFP pLKO.1 587 CDS 100% 100% 0.880 N/A
10 TRCN0000072187 CTCTCGGCATGGACGAGCTGT CONTROL -10 GFP pLKO.1 692 CDS 100% 100% 0.000 N/A
11 TRCN0000072188 CCCGACCACATGAAGCAGCAC CONTROL -10 GFP pLKO.1 226 CDS 100% 100% 0.000 N/A
12 TRCN0000072189 CCTACGGCGTGCAGTGCTTCA CONTROL -10 GFP pLKO.1 197 CDS 100% 100% 0.000 N/A
13 TRCN0000072190 GACCACATGAAGCAGCACGAC CONTROL -10 GFP pLKO.1 229 CDS 100% 100% 0.720 N/A
14 TRCN0000072192 GAACGGCATCAAGGTGAACTT CONTROL -10 GFP pLKO.1 477 CDS 100% 100% 4.950 N/A
15 TRCN0000072193 CGACGTAAACGGCCACAAGTT CONTROL -10 GFP pLKO.1 63 CDS 100% 100% 4.950 N/A
16 TRCN0000072194 CCACATGAAGCAGCACGACTT CONTROL -10 GFP pLKO.1 231 CDS 100% 100% 4.050 N/A
17 TRCN0000072195 GCGACGTAAACGGCCACAAGT CONTROL -10 GFP pLKO.1 62 CDS 100% 100% 1.650 N/A
18 TRCN0000072196 ACGTCTATATCATGGCCGACA CONTROL -10 GFP pLKO.1 449 CDS 100% 100% 2.160 N/A
19 TRCN0000072197 CTACGGCAAGCTGACCCTGAA CONTROL -10 GFP pLKO.1 117 CDS 100% 100% 1.350 N/A
20 TRCN0000072198 GCGCGATCACATGGTCCTGCT CONTROL -10 GFP pLKO.1 645 CDS 100% 100% 0.000 N/A
21 TRCN0000072199 TGACCCTGAAGTTCATCTGCA CONTROL -10 GFP pLKO.1 128 CDS 100% 100% 2.640 N/A
22 TRCN0000072200 AGTACAACTACAACAGCCACA CONTROL -10 GFP pLKO.1 428 CDS 100% 100% 2.160 N/A
23 TRCN0000072201 GTCGAGCTGGACGGCGACGTA CONTROL -10 GFP pLKO.1 49 CDS 100% 100% 0.000 N/A
24 TRCN0000072202 GCCACAACATCGAGGACGGCA CONTROL -10 GFP pLKO.1 506 CDS 100% 100% 0.000 N/A
25 TRCN0000206973 GCACGACTTCTTCAAGTCCGC CONTROL -10 GFP pLKO.1 243 CDS 100% 100% 0.018 N/A
26 TRCN0000207020 GACCACCCTGACCTACGGCGT CONTROL -10 GFP pLKO.1 186 CDS 100% 100% 0.000 N/A
27 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC CONTROL -10 GFP pLKO.1 616 CDS 100% 100% 0.000 N/A
28 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC CONTROL -10 GFP pLKO.1 21 CDS 100% 100% 0.000 N/A
29 TRCN0000207065 GCGATCACATGGTCCTGCTGG CONTROL -10 GFP pLKO.1 647 CDS 100% 100% 0.000 N/A
30 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA CONTROL -10 GFP pLKO.1 668 CDS 100% 100% 0.000 N/A
31 TRCN0000559395 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC022 437 CDS 100% 100% 13.200 N/A
32 TRCN0000559396 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC018 437 CDS 100% 100% 13.200 N/A
33 TRCN0000559397 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC016 437 CDS 100% 100% 13.200 N/A
34 TRCN0000559399 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC023 437 CDS 100% 100% 13.200 N/A
35 TRCN0000559393 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC024 437 CDS 100% 100% 13.200 N/A
36 TRCN0000559401 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC008 437 CDS 100% 100% 13.200 N/A
37 TRCN0000559394 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC047 437 CDS 100% 100% 13.200 N/A
38 TRCN0000559403 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC046 437 CDS 100% 100% 13.200 N/A
39 TRCN0000559407 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC017 437 CDS 100% 100% 13.200 N/A
40 TRCN0000559408 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC021 437 CDS 100% 100% 13.200 N/A
41 TRCN0000231750 CAACAGCCACAACGTCTATAT CONTROL -10 GFP pLKO_TRC005 438 CDS 100% 100% 13.200 N/A
42 TRCN0000231749 CGACCACATGAAGCAGCACGA CONTROL -10 GFP pLKO_TRC005 228 CDS 100% 100% 0.720 N/A
43 TRCN0000231754 CTATATCATGGCCGACAAGCA CONTROL -10 GFP pLKO_TRC005 453 CDS 100% 100% 2.640 N/A
44 TRCN0000231753 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC005 437 CDS 100% 100% 13.200 N/A
45 TRCN0000231752 TCTCGGCATGGACGAGCTGTA CONTROL -10 GFP pLKO_TRC005 693 CDS 100% 100% 1.350 N/A
46 TRCN0000231751 CGGCATGGACGAGCTGTACAA CONTROL -10 GFP pLKO_TRC005 696 CDS 100% 100% 1.650 N/A
47 TRCN0000231748 CGGGATCACTCTCGGCATGGA CONTROL -10 GFP pLKO_TRC005 684 CDS 100% 100% 0.000 N/A
48 TRCN0000231747 TACAACAGCCACAACGTCTAT CONTROL -10 GFP pLKO_TRC005 436 CDS 100% 100% 4.950 N/A
49 TRCN0000231746 TGCCCGACAACCACTACCTGA CONTROL -10 GFP pLKO_TRC005 587 CDS 100% 100% 0.880 N/A
50 TRCN0000231764 CTCTCGGCATGGACGAGCTGT CONTROL -10 GFP pLKO_TRC005 692 CDS 100% 100% 0.000 N/A
51 TRCN0000231763 CCCGACCACATGAAGCAGCAC CONTROL -10 GFP pLKO_TRC005 226 CDS 100% 100% 0.000 N/A
52 TRCN0000231765 CCTACGGCGTGCAGTGCTTCA CONTROL -10 GFP pLKO_TRC005 197 CDS 100% 100% 0.000 N/A
53 TRCN0000231759 GACCACATGAAGCAGCACGAC CONTROL -10 GFP pLKO_TRC005 229 CDS 100% 100% 0.720 N/A
54 TRCN0000231760 GAACGGCATCAAGGTGAACTT CONTROL -10 GFP pLKO_TRC005 477 CDS 100% 100% 4.950 N/A
55 TRCN0000231761 CGACGTAAACGGCCACAAGTT CONTROL -10 GFP pLKO_TRC005 63 CDS 100% 100% 4.950 N/A
56 TRCN0000231762 CCACATGAAGCAGCACGACTT CONTROL -10 GFP pLKO_TRC005 231 CDS 100% 100% 4.050 N/A
57 TRCN0000231755 GCGACGTAAACGGCCACAAGT CONTROL -10 GFP pLKO_TRC005 62 CDS 100% 100% 1.650 N/A
58 TRCN0000231756 ACGTCTATATCATGGCCGACA CONTROL -10 GFP pLKO_TRC005 449 CDS 100% 100% 2.160 N/A
59 TRCN0000231757 CTACGGCAAGCTGACCCTGAA CONTROL -10 GFP pLKO_TRC005 117 CDS 100% 100% 1.350 N/A
60 TRCN0000231758 GCGCGATCACATGGTCCTGCT CONTROL -10 GFP pLKO_TRC005 645 CDS 100% 100% 0.000 N/A
61 TRCN0000231745 TGACCCTGAAGTTCATCTGCA CONTROL -10 GFP pLKO_TRC005 128 CDS 100% 100% 2.640 N/A
62 TRCN0000231744 AGTACAACTACAACAGCCACA CONTROL -10 GFP pLKO_TRC005 428 CDS 100% 100% 2.160 N/A
63 TRCN0000231705 GCCACAACATCGAGGACGGCA CONTROL -10 GFP pLKO_TRC005 506 CDS 100% 100% 0.000 N/A
Download CSV

All "non-targeting" hairpins matching this transcript

This list includes shRNAs that perfectly or closely match the queried transcript, but that were originally designed to target something other than the queried transcript. For example, this list can include shRNAs that were originally designed to target: (i) different isoforms or obsolete versions of the queried transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000267504 TTGACCCTGAGTTCATCTGAG human 246744 STH pLKO_TRC005 202 CDS 81% 90% N/A N/A
2 TRCN0000074878 GCCTACTACTACCAGCAGAAA human 84844 PHF5A pLKO.1 443 3UTR 85% 89% N/A N/A
3 TRCN0000286158 GCCTACTACTACCAGCAGAAA human 84844 PHF5A pLKO_TRC005 443 3UTR 85% 89% N/A N/A
4 TRCN0000222059 CCGCATCAGGTGAACATCAAA human 10626 TRIM16 pLKO.1 876 CDS 81% 85% N/A N/A
5 TRCN0000333849 CCGCATCAGGTGAACATCAAA human 10626 TRIM16 pLKO_TRC005 876 CDS 81% 85% N/A N/A
6 TRCN0000414038 GTGGCACAGCTGGAGTATAAA human 4898 NRD1 pLKO_TRC005 2759 CDS 81% 85% N/A N/A
7 TRCN0000038321 CCTGAAGTCATTGGACCACTT human 6554 SLC10A1 pLKO.1 908 CDS 78% 85% N/A N/A
8 TRCN0000033383 CCACAACACGAGGACGGAGAA human 7473 WNT3 pLKO.1 1073 CDS 77% 85% N/A N/A
9 TRCN0000045016 CATCGTGGTGAGCTGGATGAT human 293 SLC25A6 pLKO.1 719 CDS 77% 85% N/A N/A
10 TRCN0000064928 GCGCCTACAAATCGAGGACTT human 51079 NDUFA13 pLKO.1 634 CDS 77% 85% N/A N/A
11 TRCN0000116441 CCACAACATCGTGACGGCGCA human 7122 CLDN5 pLKO.1 581 CDS 77% 85% N/A N/A
12 TRCN0000145006 GACCCTGAAGTTATCTCTATA human 80133 C1orf129 pLKO.1 1610 CDS 77% 85% N/A N/A
13 TRCN0000418307 CCGAAGTGCTCGTCCAGTATT human 1302 COL11A2 pLKO_TRC005 756 CDS 77% 85% N/A N/A
14 TRCN0000022398 CAACGAGAACGCCACATGGTC human 55658 RNF126 pLKO.1 1015 CDS 84% 82% N/A N/A
15 TRCN0000243830 CATGCCCAAGGACATCCAGTT human 653604 HIST2H3D pLKO_TRC005 360 CDS 75% 81% N/A N/A
16 TRCN0000059970 CACAAGCTGGTGTTCCTACAA human 22879 MON1B pLKO.1 811 CDS 82% 80% N/A N/A
17 TRCN0000378682 ACAACTGGAGAGAACTATAAA human 329 BIRC2 pLKO_TRC005 2654 CDS 78% 80% N/A N/A
18 TRCN0000007231 GCATCACATCAGGAGGATGTT human 8837 CFLAR pLKO.1 1480 CDS 73% 80% N/A N/A
19 TRCN0000020555 GCCACACTTCAGCTGTCTGTA human 6689 SPIB pLKO.1 38 CDS 73% 80% N/A N/A
20 TRCN0000057866 CCATGAAGTATCTGGACCAAA human 6356 CCL11 pLKO.1 392 CDS 73% 80% N/A N/A
21 TRCN0000057952 CCATGAAGCATCTGGACCAAA human 6355 CCL8 pLKO.1 712 CDS 73% 80% N/A N/A
22 TRCN0000154355 CTTCAGAGGAAGAGCAACAAA human 391267 ANKRD20A11P pLKO.1 949 3UTR 73% 80% N/A N/A
23 TRCN0000199135 CACTGACCTGAACGCAGTCAT human 225689 MAPK15 pLKO.1 329 CDS 73% 80% N/A N/A
24 TRCN0000344522 CACTGACCTGAACGCAGTCAT human 225689 MAPK15 pLKO_TRC005 329 CDS 73% 80% N/A N/A
25 TRCN0000022396 GCAACGAGAACGCCACATGGT human 55658 RNF126 pLKO.1 1014 CDS 80% 78% N/A N/A
26 TRCN0000430217 TGGTGAAGCGCAAGTTGAAGG human 201191 SAMD14 pLKO_TRC005 1516 CDS 79% 77% N/A N/A
27 TRCN0000140016 GAGCAAGGAGAAGCTGTTGAT human 203062 TSNARE1 pLKO.1 1459 CDS 75% 77% N/A N/A
28 TRCN0000369225 AGAAGTACGTCAAGGAGAACC human 256302 C17orf103 pLKO_TRC005 289 CDS 75% 77% N/A N/A
29 TRCN0000159917 CAGCAAAGACAAAGAGAAGAA human 55257 C20orf20 pLKO.1 509 CDS 70% 77% N/A N/A
30 TRCN0000157444 GCTGGAGAACTGACAACACTA human 7105 TSPAN6 pLKO.1 920 3UTR 70% 77% N/A N/A
31 TRCN0000150021 CAACAAGGTCTTCAAGTTCAA human 57623 ZFAT pLKO.1 1003 CDS 70% 77% N/A N/A
32 TRCN0000245653 CCAAGCTGGACCACTACAAAG human 192111 PGAM5 pLKO_TRC005 287 CDS 70% 77% N/A N/A
33 TRCN0000296724 CAACAACCTGGACAAGCTATG human 3976 LIF pLKO_TRC005 337 CDS 70% 77% N/A N/A
34 TRCN0000312475 GCTGGAGAACTGACAACACTA human 7105 TSPAN6 pLKO_TRC005 920 3UTR 70% 77% N/A N/A
35 TRCN0000437190 GCTACGAGGAGTGCATCATAG human 3482 IGF2R pLKO_TRC005 5886 CDS 70% 77% N/A N/A
36 TRCN0000413906 ACGTCAAGTAGGACAACATAT human 23304 UBR2 pLKO_TRC005 1563 CDS 70% 77% N/A N/A
37 TRCN0000270653 TCAAGGAAGATGGCAACATTA mouse 574403 Fam196b pLKO_TRC005 805 CDS 80% 89% N/A N/A
38 TRCN0000375784 TCACGGACTACGGCAACTATG mouse 219249 Tdrd3 pLKO_TRC005 2273 CDS 80% 89% N/A N/A
39 TRCN0000241466 TACAACACACAACTCTATATA mouse 76719 1700081L11Rik pLKO_TRC005 1300 CDS 83% 86% N/A N/A
40 TRCN0000024366 TCGAGTGAAGCTCATCGACTT mouse 545156 Kalrn pLKO.1 1240 CDS 86% 85% N/A N/A
41 TRCN0000328670 ATCATGGCCACAAACCGAATA mouse 19179 Psmc1 pLKO_TRC005 989 CDS 81% 85% N/A N/A
42 TRCN0000065844 GCTGGGAACAACTCAACAGAA mouse 18654 Pgf pLKO.1 401 CDS 78% 85% N/A N/A
43 TRCN0000087391 GCTGCCGACAAGGACTACCAT mouse 50760 Fbxo17 pLKO.1 1073 CDS 77% 85% N/A N/A
44 TRCN0000102969 GCTGTCCTACAACCATACCAA mouse 14403 Gabrd pLKO.1 397 CDS 77% 85% N/A N/A
45 TRCN0000120751 GACCTGAAGCACGACTTCAAT mouse 57444 Isg20 pLKO.1 518 CDS 79% 81% N/A N/A
46 TRCN0000350156 GACCTGAAGCACGACTTCAAT mouse 57444 Isg20 pLKO_TRC005 571 CDS 79% 81% N/A N/A
47 TRCN0000092885 CATGCCCAAGGACATCCAGTT mouse 97114 Hist2h3c2 pLKO.1 546 CDS 75% 81% N/A N/A
48 TRCN0000111263 CCGAAGAACTGCATCAGTGAA mouse 17939 Naga pLKO.1 252 CDS 82% 80% N/A N/A
49 TRCN0000334464 CCGAAGAACTGCATCAGTGAA mouse 17939 Naga pLKO_TRC005 272 CDS 82% 80% N/A N/A
50 TRCN0000085075 CCTATGGCAACTATCCTGAAA mouse 14013 Mecom pLKO.1 71 CDS 78% 80% N/A N/A
51 TRCN0000100049 TCAGGGCCTCAAGAGAAGAAA mouse 27218 Slamf1 pLKO.1 951 CDS 78% 80% N/A N/A
52 TRCN0000089425 AGCACCTTCTTCTAGTCCCAA mouse 20256 Clec11a pLKO.1 410 CDS 73% 80% N/A N/A
53 TRCN0000193886 CCACAAGTATATACATGGTGA mouse 171197 Vmn1r23 pLKO.1 578 CDS 73% 80% N/A N/A
54 TRCN0000188882 GTGCTTATCCTTCGAGCTGTT mouse 258355 Olfr677 pLKO.1 658 CDS 73% 80% N/A N/A
55 TRCN0000366886 CATGGAGACTCTACGAGTATA mouse 21976 Top3b pLKO_TRC005 1494 CDS 73% 80% N/A N/A
56 TRCN0000268955 ACTACGACCCAAACGTCTTTA mouse 71868 1700023E05Rik pLKO_TRC005 1415 CDS 79% 77% N/A N/A
57 TRCN0000250610 CGGCATCAAGCTGCACAAGAA mouse 72500 Ier5l pLKO_TRC005 266 CDS 75% 77% N/A N/A
58 TRCN0000176338 CATCGAGAAGAGAATCGACAA mouse 216049 Zfp365 pLKO.1 595 CDS 70% 77% N/A N/A
59 TRCN0000454647 TCAAGGACTTCATGATCCAAG mouse 68816 Ppil1 pLKO_TRC005 214 CDS 70% 77% N/A N/A
Download CSV

All hairpins matching this transcript

(this is the union of the above two tables, provided here as a single download link)

Download CSV

Hairpin Candidate Sequences

Show high scoring hairpin designs for this transcript.

ORFs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 ccsbBroad301_99984 pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
2 ccsbBroad301_99999 pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
3 ccsbBroad301_99998 pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
4 ccsbBroad301_99997 pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
5 ccsbBroad304_99997 pLX_TRC304 71.7% 99.7% 99.5% V5 (not translated due to frame shift) 93C>T;491T>C
6 ccsbBroad304_99999 pLX_TRC304 72.2% 99.7% 99.5% V5 (not translated due to frame shift) 93C>T;491T>C
7 ccsbBroad304_99998 pLX_TRC304 71.7% 99.7% 99.5% V5 (not translated due to frame shift) 93C>T;491T>C
8 BRDN0000559443 pLX_TRC307 0% 99.7% 99.5% V5 93C>T;491T>C
9 BRDN0000464774 pDONR221 0% 99.7% 99.5% None 93C>T;491T>C
10 BRDN0000464781 pLX_TRC302 0% 99.7% 99.5% V5 93C>T;491T>C
11 BRDN0000556273 pLX_TRC303 0% 99.7% 99.5% None 93C>T;491T>C
12 BRDN0000556285 pLX_TRC305 0% 99.7% 99.5% None 93C>T;491T>C
13 BRDN0000556297 pLX_TRC306 0% 99.7% 99.5% V5 93C>T;491T>C
14 BRDN0000556276 pLXI_TRC401 0% 99.7% 99.5% None 93C>T;491T>C
15 BRDN0000556271 pLXI_TRC402 0% 99.7% 99.5% HA 93C>T;491T>C
16 BRDN0000556283 pLX_TRC311 0% 99.7% 99.5% V5 93C>T;491T>C
17 BRDN0000556281 pLX_TRC313 0% 99.7% 99.5% V5 93C>T;491T>C
18 BRDN0000556292 pLX_TRC314 0% 99.7% 99.5% V5 93C>T;491T>C
19 BRDN0000556298 pLX_TRC315 0% 99.7% 99.5% V5 93C>T;491T>C
20 BRDN0000556286 pLXI_TRC403 0% 99.7% 99.5% V5 93C>T;491T>C
21 BRDN0000464775 pDONR221 0% 99.7% 99.5% None 93C>T;491T>C
22 BRDN0000464776 pDONR221 0% 99.7% 99.5% None 93C>T;491T>C
23 BRDN0000464762 pDONR223 0% 99.1% 97.9% None (many diffs)
24 ccsbBroad301_99980 pLX_TRC301 0% 99.1% 97.9% None (many diffs)
25 ccsbBroad301_99987 pLX_TRC301 0% 99.1% 97.9% None (many diffs)
26 ccsbBroad301_99986 pLX_TRC301 0% 99.1% 97.9% None (many diffs)
27 ccsbBroad301_99985 pLX_TRC301 0% 99.1% 97.9% None (many diffs)
28 ccsbBroad304_99986 pLX_TRC304 82.4% 99.1% 97.9% V5 (many diffs)
29 BRDN0000464777 pLX_TRC302 0% 99.1% 97.9% V5 (many diffs)
30 ccsbBroad304_99985 pLX_TRC304 72.2% 99% 97.4% V5 (not translated due to prior stop codon) (many diffs)
31 ccsbBroad304_99987 pLX_TRC304 88.7% 98.8% 24.1% V5 (not translated due to frame shift) (many diffs)
32 BRDN0000464763 pDONR223 0% 99.1% 97.9% None (many diffs)
33 BRDN0000464764 pDONR223 0% 99.1% 97.9% None (many diffs)
Download CSV