Transcript: Mouse XM_006513878.2

PREDICTED: Mus musculus Rho guanine nucleotide exchange factor (GEF) 25 (Arhgef25), transcript variant X1, mRNA.

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

shRNA constructs matching this transcript with 100% SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match

This list includes all shRNAs that have a perfect SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to Mouse XM_006513878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

	Clone ID	Target Seq	Vector	Match Position	Match Region[?]The region of the transcript where the match occurs (5UTR, CDS, 3UTR). NOTE: all matches to non-coding transcripts are labeled 3UTR.	SDR Match %[?]Percent match of the "Specificity-Defining Region" of the hairpin target sequence to transcript RNA sequence. The SDR is defined as the initial 19 bases of the (21mer) target sequence. 84% = 16/19 89% = 17/19 95% = 18/19 100% = 19/19	Intrinsic Score[?]Also called "original score", this assesses the target sequence for predicted cloneability and knockdown performance.	Adjusted Score[?]Also called "specificity score", this is a function of the intrinsic score and the specificity factor.	Matches Other Mouse Gene?[?]Does this construct also match another Mouse gene an equal or better degree?	Orig. Target Gene[?]The gene that this construct was originally designed to target	Addgene[?]Link to this entity's page in the Addgene catalog, if available
1	TRCN0000340839	GTGGTGTACTGCCAGAATAAA	pLKO_005	1504	CDS	100%	15.000	21.000	N	Arhgef25	n/a
2	TRCN0000120372	GCATGATTCCTCAATGAATTT	pLKO.1	2525	3UTR	100%	13.200	18.480	N	Arhgef25	n/a
3	TRCN0000340771	GCATGATTCCTCAATGAATTT	pLKO_005	2525	3UTR	100%	13.200	18.480	N	Arhgef25	n/a
4	TRCN0000120373	CGTGACTTTCTCAACGCATTA	pLKO.1	2161	CDS	100%	10.800	15.120	N	Arhgef25	n/a
5	TRCN0000340838	GTGACTTTCTCAACGCATTAC	pLKO_005	2162	CDS	100%	10.800	15.120	N	Arhgef25	n/a
6	TRCN0000340772	ACCTAAGCGATGCAATGATAT	pLKO_005	1743	CDS	100%	13.200	10.560	N	Arhgef25	n/a
7	TRCN0000120374	AGTGTTTGAAAGATCCCGATT	pLKO.1	1436	CDS	100%	4.050	3.240	N	Arhgef25	n/a
8	TRCN0000340840	TGTCTTCCTGTTCGAGCAAAT	pLKO_005	1896	CDS	100%	10.800	7.560	N	Arhgef25	n/a
9	TRCN0000120375	CCAACTTTAACCACAGGACAA	pLKO.1	1084	CDS	100%	4.050	2.835	N	Arhgef25	n/a
10	TRCN0000120376	GCATTACAGTCACCCATTGAA	pLKO.1	2176	CDS	100%	5.625	3.375	N	Arhgef25	n/a
11	TRCN0000230916	ATGAGTGGCACCGAGACTATT	pLKO_005	1397	CDS	100%	13.200	10.560	N	ARHGEF25	n/a
12	TRCN0000021610	GCTCTGGAAAGGAGTATGTAT	pLKO.1	1225	CDS	100%	5.625	3.938	N	ARHGEF25	n/a

Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to the transcript XM_006513878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Download CSV