Transcript: Mouse NM_175935.3

Mus musculus glucose 6 phosphatase, catalytic, 3 (G6pc3), mRNA.

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

shRNA constructs matching this transcript with 100% SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match

This list includes all shRNAs that have a perfect SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to Mouse NM_175935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

	Clone ID	Target Seq	Vector	Match Position	Match Region[?]The region of the transcript where the match occurs (5UTR, CDS, 3UTR). NOTE: all matches to non-coding transcripts are labeled 3UTR.	SDR Match %[?]Percent match of the "Specificity-Defining Region" of the hairpin target sequence to transcript RNA sequence. The SDR is defined as the initial 19 bases of the (21mer) target sequence. 84% = 16/19 89% = 17/19 95% = 18/19 100% = 19/19	Intrinsic Score[?]Also called "original score", this assesses the target sequence for predicted cloneability and knockdown performance.	Adjusted Score[?]Also called "specificity score", this is a function of the intrinsic score and the specificity factor.	Matches Other Mouse Gene?[?]Does this construct also match another Mouse gene an equal or better degree?	Orig. Target Gene[?]The gene that this construct was originally designed to target	Addgene[?]Link to this entity's page in the Addgene catalog, if available
1	TRCN0000081140	CGCAGCTCTTTGGCCTGTAAT	pLKO.1	584	CDS	100%	13.200	18.480	N	G6pc3	n/a
2	TRCN0000363622	CGCAGCTCTTTGGCCTGTAAT	pLKO_005	584	CDS	100%	13.200	18.480	N	G6pc3	n/a
3	TRCN0000081142	TGGGCGATCCTAAGAATCTTT	pLKO.1	322	CDS	100%	5.625	7.875	N	G6pc3	n/a
4	TRCN0000327630	TGGGCGATCCTAAGAATCTTT	pLKO_005	322	CDS	100%	5.625	7.875	N	G6pc3	n/a
5	TRCN0000081139	CCTCATGTATTGGACTCTCTT	pLKO.1	860	CDS	100%	4.950	3.960	N	G6pc3	n/a
6	TRCN0000327548	CCTCATGTATTGGACTCTCTT	pLKO_005	860	CDS	100%	4.950	3.960	N	G6pc3	n/a
7	TRCN0000081138	CCGCTCACCTTGAACTTCATT	pLKO.1	1360	3UTR	100%	5.625	3.938	N	G6pc3	n/a
8	TRCN0000327572	CCGCTCACCTTGAACTTCATT	pLKO_005	1360	3UTR	100%	5.625	3.938	N	G6pc3	n/a
9	TRCN0000081141	TGGCTTATTGTACCTTCCTAT	pLKO.1	670	CDS	100%	4.950	3.465	N	G6pc3	n/a
10	TRCN0000327549	TGGCTTATTGTACCTTCCTAT	pLKO_005	670	CDS	100%	4.950	3.465	N	G6pc3	n/a

Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to the transcript NM_175935.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Download CSV