Transcript: Mouse NM_172573.2

Mus musculus endo-beta-N-acetylglucosaminidase (Engase), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Engase (217364)
Length:
3922
CDS:
27..2231

Additional Resources:

NCBI RefSeq record:
NM_172573.2
NBCI Gene record:
Engase (217364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215757 GGCTTCTTTACCAACTATAAC pLKO.1 897 CDS 100% 13.200 18.480 N Engase n/a
2 TRCN0000266922 TCAACGCTGCTATGAGGTAAA pLKO_005 1694 CDS 100% 10.800 15.120 N Engase n/a
3 TRCN0000283371 TTCTACCACTGGCAGTATATC pLKO_005 456 CDS 100% 13.200 10.560 N Engase n/a
4 TRCN0000283374 AGTCTGGTGAGCAAGCAATTA pLKO_005 3730 3UTR 100% 13.200 9.240 N Engase n/a
5 TRCN0000266923 TGGCTTCTTTACCAACTATAA pLKO_005 896 CDS 100% 13.200 9.240 N Engase n/a
6 TRCN0000266924 TGTCCATGGTGTACAAGTTTG pLKO_005 1486 CDS 100% 10.800 7.560 N Engase n/a
7 TRCN0000191997 GAATGTCACCATTTCTCAGAT pLKO.1 1859 CDS 100% 4.950 3.465 N Engase n/a
8 TRCN0000191493 GATTGCTCAGTTCTTTCGTTT pLKO.1 668 CDS 100% 4.950 3.465 N Engase n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.