Transcript: Human NM_001145306.1

Homo sapiens cyclin dependent kinase 6 (CDK6), transcript variant 2, mRNA.

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

	Clone ID	Target Seq	Vector	PAM Seq	Cut Position	Cut % of CDS Length	Exon	On Target Score[?]Scoring system: RS3seq-Chen2013+RS3target	Other Matching Genes	Orig. Target Gene[?]The gene that this construct was originally designed to target	Notes	Addgene[?]Link to this entity's page in the Addgene catalog, if available
1	BRDN0001148604	AACACTCCAGAGATCCACGG	pXPR_003	GGG	598	61%	5	1.0247	CDK6	CDK6		75646
2	BRDN0001146904	TGGCTCACCTGACCACGTTG	pXPR_003	GGG	224	23%	2	0.5969	CDK6	CDK6		75644
3	BRDN0001147855	GCCCGCGACTTGAAGAACGG	pXPR_003	AGG	104	11%	2	0.4819	CDK6	CDK6		75645
4	BRDN0001145692	CATTGCAGGTCGTCACGCTG	pXPR_003	TGG	546	56%	5	0.3195	CDK6	CDK6		75643

Download CSV

shRNA constructs matching this transcript with 100% SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match

This list includes all shRNAs that have a perfect SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to Human NM_001145306.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

	Clone ID	Target Seq	Vector	Match Position	Match Region[?]The region of the transcript where the match occurs (5UTR, CDS, 3UTR). NOTE: all matches to non-coding transcripts are labeled 3UTR.	SDR Match %[?]Percent match of the "Specificity-Defining Region" of the hairpin target sequence to transcript RNA sequence. The SDR is defined as the initial 19 bases of the (21mer) target sequence. 84% = 16/19 89% = 17/19 95% = 18/19 100% = 19/19	Intrinsic Score[?]Also called "original score", this assesses the target sequence for predicted cloneability and knockdown performance.	Adjusted Score[?]Also called "specificity score", this is a function of the intrinsic score and the specificity factor.	Matches Other Human Gene?[?]Does this construct also match another Human gene an equal or better degree?	Orig. Target Gene[?]The gene that this construct was originally designed to target	Addgene[?]Link to this entity's page in the Addgene catalog, if available
1	TRCN0000009877	GAGTAGTGCATCGCGATCTAA	pLKO.1	936	CDS	100%	5.625	7.875	N	CDK6	n/a
2	TRCN0000039743	CGATCAAGACTTGACCACTTA	pLKO.1	820	CDS	100%	4.950	6.930	N	CDK6	n/a
3	TRCN0000039747	CGTGGAAGTTCAGATGTTGAT	pLKO.1	1175	CDS	100%	4.950	6.930	N	CDK6	n/a
4	TRCN0000196337	GTAACAGATATCGATGAACTA	pLKO.1	1313	CDS	100%	4.950	6.930	N	CDK6	n/a
5	TRCN0000194866	CAGATGTTGATCAACTAGGAA	pLKO.1	1185	CDS	100%	3.000	4.200	N	CDK6	n/a
6	TRCN0000199114	CCAGAACACCTCGGAGCTGAA	pLKO.1	1468	CDS	100%	1.350	1.080	N	CDK6	n/a
7	TRCN0000194933	CCAAACTAACTTTAGTGTTTG	pLKO.1	792	CDS	100%	1.080	0.864	N	CDK6	n/a
8	TRCN0000194893	CATGAGATGTTCCTATCTTAA	pLKO.1	4889	3UTR	100%	13.200	9.240	N	CDK6	n/a
9	TRCN0000039746	CTTCTGAAGTGTTTGACATTT	pLKO.1	1346	CDS	100%	13.200	9.240	N	CDK6	n/a
10	TRCN0000023152	CTTGACCACTTACTTGGATAA	pLKO.1	829	CDS	100%	10.800	7.560	N	Cdk6	n/a
11	TRCN0000196261	GAGAAGTTTGTAACAGATATC	pLKO.1	1304	CDS	100%	10.800	7.560	N	CDK6	n/a
12	TRCN0000196617	GCAGAAATGTTTCGTAGAAAG	pLKO.1	1145	CDS	100%	10.800	7.560	N	CDK6	n/a
13	TRCN0000055435	TCTGGAGTGTTGGCTGCATAT	pLKO.1	1122	CDS	100%	10.800	7.560	N	CDK6	n/a
14	TRCN0000039745	CAACCAATTGAGAAGTTTGTA	pLKO.1	1295	CDS	100%	5.625	3.938	N	CDK6	n/a
15	TRCN0000039744	GACCTGGAAAGGTGCAAAGAA	pLKO.1	1421	CDS	100%	5.625	3.938	N	CDK6	n/a
16	TRCN0000000485	CCACTGAAACCATAAAGGATA	pLKO.1	870	CDS	100%	4.950	3.465	N	CDK6	n/a
17	TRCN0000000486	CGAACAGACAGAGAAACCAAA	pLKO.1	776	CDS	100%	4.950	3.465	N	CDK6	n/a
18	TRCN0000000487	GAAGAAGACTGGCCTAGAGAT	pLKO.1	1235	CDS	100%	4.950	3.465	N	CDK6	n/a
19	TRCN0000010473	TTAAGCTGATCCTGCGGAGAA	pLKO.1	1515	3UTR	100%	4.050	2.835	N	CDK6	n/a
20	TRCN0000010074	TCGATGAACTAGGCAAAGACC	pLKO.1	1323	CDS	100%	2.640	1.848	N	CDK6	n/a
21	TRCN0000010081	GTCTCACCCATACTTCCAGGA	pLKO.1	1402	CDS	100%	2.160	1.512	N	CDK6	n/a
22	TRCN0000009878	CCATACTTCCAGGACCTGGAA	pLKO.1	1409	CDS	100%	0.264	0.185	N	CDK6	n/a
23	TRCN0000000488	CAGACAGAGAAACCAAACTAA	pLKO.1	780	CDS	100%	5.625	3.375	N	CDK6	n/a
24	TRCN0000010082	GACTTTCTTCATTCACACCGA	pLKO.1	917	CDS	100%	0.660	0.396	N	CDK6	n/a
25	TRCN0000023151	GCAAAGACCTACTTCTGAAAT	pLKO.1	1335	CDS	100%	13.200	9.240	N	Cdk6	n/a

Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?]The SDR or "Specificity-Defining Region" encompasses the 19 bases within the shRNA stem region that are retained during siRNA processing/production. These are thus the bases that define the target specificity of the shRNA. Note that, while our shRNA designs nearly always extend the stem by two additional bases matching the intended target transcript (reported in the "Target Seq" column), these additional bases are not relevant to target specificity. match to the transcript NM_001145306.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Download CSV