Transcript: Mouse NM_001127318.1

Mus musculus guanylate cyclase 2c (Gucy2c), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Gucy2c (14917)
Length:
3951
CDS:
137..3355

Additional Resources:

NCBI RefSeq record:
NM_001127318.1
NBCI Gene record:
Gucy2c (14917)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001127318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360622 ACCGACACGCGGTAGACATTT pLKO_005 2793 CDS 100% 13.200 18.480 N Gucy2c n/a
2 TRCN0000027672 CGTTCATGGATTGGGAGTTTA pLKO.1 1884 CDS 100% 13.200 18.480 N Gucy2c n/a
3 TRCN0000360623 CTCCGACGGTCTGATTCATAA pLKO_005 388 CDS 100% 13.200 18.480 N Gucy2c n/a
4 TRCN0000360693 CTGCGTGAAGCCGACCTAAAT pLKO_005 341 CDS 100% 13.200 9.240 N Gucy2c n/a
5 TRCN0000027584 CCTGGAACTCTTCGTATGTTT pLKO.1 693 CDS 100% 5.625 3.938 N Gucy2c n/a
6 TRCN0000027658 CCTACAAAGAACCTATGCAAA pLKO.1 273 CDS 100% 4.950 3.465 N Gucy2c n/a
7 TRCN0000027664 GCCAGCTACAAGAAAGGCTTT pLKO.1 3284 CDS 100% 4.050 2.835 N Gucy2c n/a
8 TRCN0000027670 CCAGGAAATACAAGGTTCTTA pLKO.1 1299 CDS 100% 5.625 3.375 N Gucy2c n/a
9 TRCN0000002023 CGACAGTGCAAATACGACAAA pLKO.1 1646 CDS 100% 4.950 6.930 N GUCY2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001127318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.