Transcript: Luciferase.1

Hahn Lab Luciferase.1
luciferase cloned from BD pTAL-luc
Hahn Lab Luciferase
CDS Start:
CDS End:

Hairpins designed to target this transcript.

No results found.

All "non-targeting" hairpins matching this transcript

This list includes shRNAs that perfectly or closely match the queried transcript, but that were originally designed to target something other than the queried transcript. For example, this list can include shRNAs that were originally designed to target: (i) different isoforms or obsolete versions of the queried transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
51 TRCN0000157368 CTCTGTCAAGTACAAAGGCCA human 84954 MPND pLKO.1 462 CDS 86% 90% N/A N/A
52 TRCN0000179486 GCCCTTGTTCCTGAAACAATT human 5557 PRIM1 pLKO.1 797 CDS 90% 89% N/A N/A
53 TRCN0000147609 GAGAAAGAGATCGTGAGATTA human 26118 WSB1 pLKO.1 344 CDS 90% 89% N/A N/A
54 TRCN0000275244 GCCCTTGTTCCTGAAACAATT human 5557 PRIM1 pLKO_TRC005 797 CDS 90% 89% N/A N/A
55 TRCN0000045367 GCTTGGCAGAAGCTATGCAAA human 56474 CTPS2 pLKO.1 1323 CDS 85% 89% N/A N/A
56 TRCN0000162944 GAGACTACAGCAGCTCTTCAA human 54543 TOMM7 pLKO.1 53 CDS 80% 89% N/A N/A
57 TRCN0000424492 CGAAAGGTCTTGACCTGAATG human 93611 FBXO44 pLKO_TRC005 1084 3UTR 80% 89% N/A N/A
58 TRCN0000220031 CTGATTGCAAATAGGCATTTA human 54845 ESRP1 pLKO.1 2482 3UTR 86% 85% N/A N/A
59 TRCN0000006167 CGTCATCAGTATTCTGATTAT human 9414 TJP2 pLKO.1 1458 CDS 81% 85% N/A N/A
60 TRCN0000020753 GCTTTGATTCCAAGGATGGTT human 50805 IRX4 pLKO.1 421 CDS 81% 85% N/A N/A
61 TRCN0000074810 CTGGAGACATTTCTACTGGTA human 6204 RPS10 pLKO.1 233 CDS 81% 85% N/A N/A
62 TRCN0000157516 GACGAAAGTGTCGCAGTCTTT human 9398 CD101 pLKO.1 1860 CDS 81% 85% N/A N/A
63 TRCN0000161513 GCTGAAACCAATCCCAGAATA human 10758 TRAF3IP2 pLKO.1 260 CDS 81% 85% N/A N/A
64 TRCN0000188076 CCCTCTGATTGGTATCCATTT human 11037 STON1 pLKO.1 2000 CDS 81% 85% N/A N/A
65 TRCN0000298184 CTGGAGACATTTCTACTGGTA human 6204 RPS10 pLKO_TRC005 257 CDS 81% 85% N/A N/A
66 TRCN0000359105 TCTGGATTGACAAGATCAAAT human 22985 ACIN1 pLKO_TRC005 3456 CDS 81% 85% N/A N/A
67 TRCN0000315435 CGTCATCAGTATTCTGATTAT human 9414 TJP2 pLKO_TRC005 1458 CDS 81% 85% N/A N/A
68 TRCN0000001991 GAAGACTGGAAGCTGGAGATT human 4294 MAP3K10 pLKO.1 1420 CDS 78% 85% N/A N/A
69 TRCN0000028111 GCTGCTGTCAACCCTTTCTTT human 317749 DHRS4L2 pLKO.1 387 CDS 77% 85% N/A N/A
70 TRCN0000152541 GCCAAGATGTTCATTTGCCTA human 150350 ENTHD1 pLKO.1 880 CDS 77% 85% N/A N/A
71 TRCN0000164836 CAAGATCTTGAAGCAGGTGCA human 126536 LOC126536 pLKO.1 1456 CDS 77% 85% N/A N/A
72 TRCN0000336610 TGGGCTCAGGAGACGACATTT human 57460 PPM1H pLKO_TRC005 1630 CDS 77% 85% N/A N/A
73 TRCN0000424224 CTGAGCACCCTTCAGATTAAG human 223082 ZNRF2 pLKO_TRC005 1761 CDS 77% 85% N/A N/A
74 TRCN0000010098 GCCGTGGTTCTTTGGAGCAAT human 2444 FRK pLKO.1 789 CDS 77% 85% N/A N/A
75 TRCN0000438473 ACGCAGGTGCATGGTCTTCAA human 2516 NR5A1 pLKO_TRC005 1027 CDS 75% 81% N/A N/A
76 TRCN0000117723 CCAGAAGATCATGTTTGGCAA human 23481 PES1 pLKO.1 1718 CDS 82% 80% N/A N/A
77 TRCN0000145207 GAACATGAAGCTCAACACTAT human 55279 ZNF654 pLKO.1 932 CDS 82% 80% N/A N/A
78 TRCN0000359762 TGGCAGAGCTATAAGCGTTAT human 57134 MAN1C1 pLKO_TRC005 886 CDS 82% 80% N/A N/A
79 TRCN0000300707 CCAGAAGATCATGTTTGGCAA human 23481 PES1 pLKO_TRC005 1718 CDS 82% 80% N/A N/A
80 TRCN0000420606 TGGAGCTCTGGACTCCTAAAT human 219541 MED19 pLKO_TRC005 616 3UTR 78% 80% N/A N/A
81 TRCN0000006766 CAAGTACAACGCCAACAAGAC human 1504 CTRB1 pLKO.1 502 CDS 73% 80% N/A N/A
82 TRCN0000019783 GCTGGGCATAATGAAGAGGAT human 8204 NRIP1 pLKO.1 411 CDS 73% 80% N/A N/A
83 TRCN0000358936 GTTCCAACACCCACATCATTC human 653166 OR1D4 pLKO_TRC005 620 CDS 73% 80% N/A N/A
84 TRCN0000257355 GTGAGATCCTAGTGATAATAG human 1399 CRKL pLKO_TRC005 949 CDS 73% 80% N/A N/A
85 TRCN0000428433 TCCGAGAGGTCATGATTATAG human 84186 ZCCHC7 pLKO_TRC005 619 CDS 73% 80% N/A N/A
86 TRCN0000434171 GACCTTCAGGATCAAGATTAT human 10180 RBM6 pLKO_TRC005 1563 CDS 73% 80% N/A N/A
87 TRCN0000168883 CTGGGAAAGAAACACTTCCTT human 152404 IGSF11 pLKO.1 1544 3UTR 76% 78% N/A N/A
88 TRCN0000015414 CAAGAAGGACAAGTTCGCCTT human 11166 SOX21 pLKO.1 347 CDS 75% 77% N/A N/A
89 TRCN0000364749 TCTGAGAGACCCTGGATTAAA human 57136 C20orf3 pLKO_TRC005 1107 CDS 75% 77% N/A N/A
90 TRCN0000376409 TGCGGATATGGACGGGAAATC human 55959 SULF2 pLKO_TRC005 1464 CDS 75% 77% N/A N/A
91 TRCN0000380069 TAAAGGAGAAGTGGCTGAATG human 26469 PTPN18 pLKO_TRC005 586 CDS 75% 77% N/A N/A
92 TRCN0000000409 GATCCTCAAGAAGAAGAAGTT human 6794 STK11 pLKO.1 505 CDS 70% 77% N/A N/A
93 TRCN0000001670 GCCAACATTTCCCTTCTTCCA human 5468 PPARG pLKO.1 1626 3UTR 70% 77% N/A N/A
94 TRCN0000003768 TGGAAGAAACGCCTGGAGAAT human 1728 NQO1 pLKO.1 672 CDS 70% 77% N/A N/A
95 TRCN0000073244 CCTGCGAGAATCTCCATGATT human 285498 RNF212 pLKO.1 627 CDS 70% 77% N/A N/A
96 TRCN0000148276 CTTCACTTACGAGTACATCAT human 360023 ZBTB41 pLKO.1 1822 CDS 70% 77% N/A N/A
97 TRCN0000152594 GATAGGCAAGAAGTTGCAGAA human 4146 MATN1 pLKO.1 1815 CDS 70% 77% N/A N/A
98 TRCN0000183686 GCTGGAAGACTGAATAATGAA human 11061 LECT1 pLKO.1 712 CDS 70% 77% N/A N/A
99 TRCN0000137982 GAATACTGTGTGCCTAGAGGA human 55859 BEX1 pLKO.1 295 CDS 70% 77% N/A N/A
100 TRCN0000350361 TGGAAGAAACGCCTGGAGAAT human 1728 NQO1 pLKO_TRC005 813 CDS 70% 77% N/A N/A
101 TRCN0000018967 CCTGCATATATGAAGAGAAAT human 117608 ZNF354B pLKO.1 550 CDS 72% 73% N/A N/A
102 TRCN0000367736 TGGTGAACATCACGCTGAGTG human 8698 S1PR4 pLKO_TRC005 279 CDS 72% 73% N/A N/A
103 TRCN0000025171 CGCTCCAACTCTCTAAGGAAA mouse 241656 Pak7 pLKO.1 859 CDS 85% 89% N/A N/A
104 TRCN0000123776 CCAGTCAATGTAACAACTGAA mouse 13627 Eef1a1 pLKO.1 940 CDS 80% 89% N/A N/A
105 TRCN0000126902 AGCACTCTGATCTACAAATTT mouse 77975 Tmem50b pLKO.1 573 CDS 80% 89% N/A N/A
106 TRCN0000309579 CCAGTCAATGTAACAACTGAA mouse 13627 Eef1a1 pLKO_TRC005 964 CDS 80% 89% N/A N/A
107 TRCN0000326596 AGCACTCTGATCTACAAATTT mouse 77975 Tmem50b pLKO_TRC005 570 CDS 80% 89% N/A N/A
108 TRCN0000365854 TTGCAGAAGCGTATGAAACAC mouse 27362 Dnajb9 pLKO_TRC005 348 CDS 80% 89% N/A N/A
109 TRCN0000120915 ACCAGACAATTGACTCATCAT mouse 11610 Agtrap pLKO.1 505 CDS 86% 85% N/A N/A
110 TRCN0000012853 GCACACTTAGACACATCAGCA mouse 12236 Bub1b pLKO.1 3402 3UTR 81% 85% N/A N/A
111 TRCN0000086794 GCCTACATGCAGCATTCTGTT mouse 319875 Tmprss11bnl pLKO.1 814 CDS 81% 85% N/A N/A
112 TRCN0000108797 ACAACTACAAAGGCTATGAAA mouse 74103 Nebl pLKO.1 333 CDS 81% 85% N/A N/A
113 TRCN0000336321 AGCACGCGTGATGACAAATAA mouse 268859 Rbfox1 pLKO_TRC005 1902 CDS 81% 85% N/A N/A
114 TRCN0000414725 ATGGATGGCTCAGTCTGAATA mouse 15002 H2-Ob pLKO_TRC005 706 CDS 81% 85% N/A N/A
115 TRCN0000448801 GCAAGGATTGATGGCACATTT mouse 231214 Cc2d2a pLKO_TRC005 3982 CDS 81% 85% N/A N/A
116 TRCN0000031312 CGTCACATTCTCTACCACCAA mouse 17287 Mep1a pLKO.1 2260 CDS 78% 85% N/A N/A
117 TRCN0000041948 GCCATTCATCTGTGGAAGAAA mouse 20148 Dhrs3 pLKO.1 2107 3UTR 78% 85% N/A N/A
118 TRCN0000054770 CAACTCTTAGAGCAGGTGTTT mouse 23955 Nek4 pLKO.1 2368 CDS 78% 85% N/A N/A
119 TRCN0000067471 CTTCTTCACGTTGAGCGTCAA mouse 12702 Socs3 pLKO.1 610 CDS 77% 85% N/A N/A
120 TRCN0000096358 GAATACGTTGAGTGCCAGAAA mouse 231866 Zfp12 pLKO.1 759 CDS 77% 85% N/A N/A
121 TRCN0000114774 TGTGGACAAGTACGGAATGAA mouse 16011 Igfbp5 pLKO.1 1470 CDS 77% 85% N/A N/A
122 TRCN0000184943 CAATCAAGAGATTCCTCATTT mouse 258508 Olfr99 pLKO.1 501 CDS 77% 85% N/A N/A
123 TRCN0000239594 ATGCTCAGAGACCTATGTTAA mouse 74901 Kbtbd11 pLKO_TRC005 7615 3UTR 77% 85% N/A N/A
124 TRCN0000270461 CAGATCAAGAATCTTCGTAAA mouse 545693 Gm13043 pLKO_TRC005 711 CDS 77% 85% N/A N/A
125 TRCN0000421942 CAAGGATTTAGTCGAAGTATG mouse 252910 Vmn1r71 pLKO_TRC005 1041 CDS 77% 85% N/A N/A
126 TRCN0000076527 GTGTGACAGCATATGATTATT mouse 20463 Cox7a2l pLKO.1 166 CDS 78% 80% N/A N/A
127 TRCN0000191263 CGGTTTACCTATTACACGATA mouse 76577 Faf2 pLKO.1 329 CDS 78% 80% N/A N/A
128 TRCN0000189750 GCTCAGTGAGATTATCAGCGA mouse 75645 1700011F14Rik pLKO.1 328 CDS 78% 80% N/A N/A
129 TRCN0000190479 GCACTGTGTTTAGAGTCCTTT mouse 245631 Mum1l1 pLKO.1 2685 3UTR 78% 80% N/A N/A
130 TRCN0000328270 AGCTGAATGAATCCATATTTC mouse 209012 Ulk4 pLKO_TRC005 1217 CDS 78% 80% N/A N/A
131 TRCN0000312335 GTGTGACAGCATATGATTATT mouse 20463 Cox7a2l pLKO_TRC005 198 CDS 78% 80% N/A N/A
132 TRCN0000009909 TGCCTAATAAGCTCCTGCGTA mouse 14394 Gabra1 pLKO.1 1200 CDS 78% 80% N/A N/A
133 TRCN0000032832 CTCTTTCAATCTCTATGACAT mouse 17224 Mcpt1 pLKO.1 344 CDS 73% 80% N/A N/A
134 TRCN0000087407 GACAACGGATTAAGGGATTAA mouse 245589 LOC245589 pLKO.1 404 CDS 73% 80% N/A N/A
135 TRCN0000103559 CGTAAGGATGAAGAGATAAAT mouse 26885 Casp8ap2 pLKO.1 637 CDS 73% 80% N/A N/A
136 TRCN0000178121 GCTGACATACATCACAGAGAA mouse 228356 1110051M20Rik pLKO.1 1222 3UTR 73% 80% N/A N/A
137 TRCN0000195949 CGTCGCTGTCAATAGCAACTT mouse 68845 Pih1d1 pLKO.1 511 CDS 73% 80% N/A N/A
138 TRCN0000198072 CTCCAACACTCTCATCTTCAT mouse 237891 Gas2l2 pLKO.1 738 CDS 73% 80% N/A N/A
139 TRCN0000258150 GAGCTGTCTGACGATCCTTAT mouse 66446 Exosc7 pLKO_TRC005 576 CDS 73% 80% N/A N/A
140 TRCN0000317888 CGTAAGGATGAAGAGATAAAT mouse 26885 Casp8ap2 pLKO_TRC005 677 CDS 73% 80% N/A N/A
141 TRCN0000340831 CGTCGCTGTCAATAGCAACTT mouse 68845 Pih1d1 pLKO_TRC005 510 CDS 73% 80% N/A N/A
142 TRCN0000271967 TCTAAAGCCTCTGATACAAAT mouse 670472 Gm11569 pLKO_TRC005 687 3UTR 79% 77% N/A N/A
143 TRCN0000088918 GCCAGGTTTCAGCGATGTTAA mouse 12662 Chm pLKO.1 3362 3UTR 75% 77% N/A N/A
144 TRCN0000251036 TGTCAGGCAGAATGGGCTTAT mouse 67976 Trabd pLKO_TRC005 521 CDS 75% 77% N/A N/A
145 TRCN0000303210 GCCAGGTTTCAGCGATGTTAA mouse 12662 Chm pLKO_TRC005 3357 3UTR 75% 77% N/A N/A
146 TRCN0000216307 GAGAATCATCTATGGTGAATG mouse 68166 Spire1 pLKO.1 670 CDS 70% 77% N/A N/A
147 TRCN0000249676 TGAATGGTACATTGGAGAATA mouse 27278 Clnk pLKO_TRC005 1055 CDS 70% 77% N/A N/A
148 TRCN0000201511 CCAACTCTTCAAAGGTGTGAA mouse 54632 Ftsj1 pLKO.1 380 CDS 68% 73% N/A N/A
149 TRCN0000190119 CCGGAAAGAACGGAAGAAAGA mouse 69202 Ptms pLKO.1 414 CDS 73% 70% N/A N/A
150 TRCN0000346743 CCGGAAAGAACGGAAGAAAGA mouse 69202 Ptms pLKO_TRC005 414 CDS 73% 70% N/A N/A
Download CSV

All hairpins matching this transcript

(this is the union of the above two tables, provided here as a single download link)

Download CSV

Hairpin Candidate Sequences

Show high scoring hairpin designs for this transcript.

ORFs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464768 pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
2 ccsbBroad301_99992 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
3 ccsbBroad301_99993 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
4 ccsbBroad301_99991 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
5 ccsbBroad301_99982 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
6 ccsbBroad304_99991 pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
7 ccsbBroad304_99992 pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
8 BRDN0000559440 pLX_TRC307 0% 99.8% 99.8% V5 1651_1653delTTG
9 BRDN0000464779 pLX_TRC302 0% 99.8% 99.8% V5 1651_1653delTTG
10 BRDN0000556282 pLX_TRC303 0% 99.8% 99.8% None 1651_1653delTTG
11 BRDN0000556262 pLX_TRC305 0% 99.8% 99.8% None 1651_1653delTTG
12 BRDN0000556299 pLX_TRC306 0% 99.8% 99.8% V5 1651_1653delTTG
13 BRDN0000556280 pLXI_TRC401 0% 99.8% 99.8% None 1651_1653delTTG
14 BRDN0000556275 pLXI_TRC402 0% 99.8% 99.8% HA 1651_1653delTTG
15 BRDN0000556301 pLX_TRC311 0% 99.8% 99.8% V5 1651_1653delTTG
16 BRDN0000556296 pLX_TRC312 0% 99.8% 99.8% V5 1651_1653delTTG
17 BRDN0000556302 pLX_TRC313 0% 99.8% 99.8% V5 1651_1653delTTG
18 BRDN0000556293 pLX_TRC314 0% 99.8% 99.8% V5 1651_1653delTTG
19 BRDN0000556270 pLX_TRC315 0% 99.8% 99.8% V5 1651_1653delTTG
20 BRDN0000556289 pLXI_TRC403 0% 99.8% 99.8% V5 1651_1653delTTG
21 ccsbBroad304_99993 pLX_TRC304 44.2% 76.6% 56.4% V5 (not translated due to prior stop codon) (many diffs)
22 BRDN0000464769 pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
23 BRDN0000464770 pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
Download CSV