Transcript: Luciferase.1

Identifier:
Hahn Lab 
Description:
luciferase cloned from BD pTAL-luc
Taxon:
CONTROL
Gene:
Hahn Lab Luciferase
Length:
1653
CDS:
1..1653

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Luciferase.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072254 ATGTTTACTACACTCGGATAT pLKO.1 745 CDS 100% 10.800 N/A N/A LUCIFERASE
2 TRCN0000231737 ATGTTTACTACACTCGGATAT pLKO_TRC005 745 CDS 100% 10.800 N/A N/A LUCIFERASE
3 TRCN0000072258 TGTCCGGTTATGTAAACAATC pLKO.1 1193 CDS 100% 10.800 N/A N/A LUCIFERASE
4 TRCN0000231721 TGTCCGGTTATGTAAACAATC pLKO_TRC005 1193 CDS 100% 10.800 N/A N/A LUCIFERASE
5 TRCN0000072253 ACACTCGGATATTTGATATGT pLKO.1 754 CDS 100% 5.625 N/A N/A LUCIFERASE
6 TRCN0000231732 ACACTCGGATATTTGATATGT pLKO_TRC005 754 CDS 100% 5.625 N/A N/A LUCIFERASE
7 TRCN0000072256 ACGCTGAGTACTTCGAAATGT pLKO.1 158 CDS 100% 5.625 N/A N/A LUCIFERASE
8 TRCN0000231742 ACGCTGAGTACTTCGAAATGT pLKO_TRC005 158 CDS 100% 5.625 N/A N/A LUCIFERASE
9 TRCN0000072250 AGAATCGTCGTATGCAGTGAA pLKO.1 229 CDS 100% 4.950 N/A N/A LUCIFERASE
10 TRCN0000231730 AGAATCGTCGTATGCAGTGAA pLKO_TRC005 229 CDS 100% 4.950 N/A N/A LUCIFERASE
11 TRCN0000072246 CAAATCACAGAATCGTCGTAT pLKO.1 221 CDS 100% 4.950 N/A N/A LUCIFERASE
12 TRCN0000231699 CAAATCACAGAATCGTCGTAT pLKO_TRC005 221 CDS 100% 4.950 N/A N/A LUCIFERASE
13 TRCN0000072261 CACTCGGATATTTGATATGTG pLKO.1 755 CDS 100% 4.950 N/A N/A LUCIFERASE
14 TRCN0000231707 CACTCGGATATTTGATATGTG pLKO_TRC005 755 CDS 100% 4.950 N/A N/A LUCIFERASE
15 TRCN0000072259 CGCTGAGTACTTCGAAATGTC pLKO.1 159 CDS 100% 4.950 N/A N/A LUCIFERASE
16 TRCN0000231715 CGCTGAGTACTTCGAAATGTC pLKO_TRC005 159 CDS 100% 4.950 N/A N/A LUCIFERASE
17 TRCN0000072247 GAATCGTCGTATGCAGTGAAA pLKO.1 230 CDS 100% 4.950 N/A N/A LUCIFERASE
18 TRCN0000231720 GAATCGTCGTATGCAGTGAAA pLKO_TRC005 230 CDS 100% 4.950 N/A N/A LUCIFERASE
19 TRCN0000072265 GTTGTGTTTGTGGACGAAGTA pLKO.1 1546 CDS 100% 4.950 N/A N/A LUCIFERASE
20 TRCN0000231727 GTTGTGTTTGTGGACGAAGTA pLKO_TRC005 1546 CDS 100% 4.950 N/A N/A LUCIFERASE
21 TRCN0000072248 AGTCAAGTAACAACCGCGAAA pLKO.1 1510 CDS 100% 4.050 N/A N/A LUCIFERASE
22 TRCN0000231718 AGTCAAGTAACAACCGCGAAA pLKO_TRC005 1510 CDS 100% 4.050 N/A N/A LUCIFERASE
23 TRCN0000072252 ACTTACGCTGAGTACTTCGAA pLKO.1 154 CDS 100% 3.000 N/A N/A LUCIFERASE
24 TRCN0000231733 ACTTACGCTGAGTACTTCGAA pLKO_TRC005 154 CDS 100% 3.000 N/A N/A LUCIFERASE
25 TRCN0000072244 ATCACAGAATCGTCGTATGCA pLKO.1 224 CDS 100% 3.000 N/A N/A LUCIFERASE
26 TRCN0000231695 ATCACAGAATCGTCGTATGCA pLKO_TRC005 224 CDS 100% 3.000 N/A N/A LUCIFERASE
27 TRCN0000072255 TCTACTGGTCTGCCTAAAGGT pLKO.1 601 CDS 100% 3.000 N/A N/A LUCIFERASE
28 TRCN0000231734 TCTACTGGTCTGCCTAAAGGT pLKO_TRC005 601 CDS 100% 3.000 N/A N/A LUCIFERASE
29 TRCN0000072262 CACTTACGCTGAGTACTTCGA pLKO.1 153 CDS 100% 2.640 N/A N/A LUCIFERASE
30 TRCN0000231736 CACTTACGCTGAGTACTTCGA pLKO_TRC005 153 CDS 100% 2.640 N/A N/A LUCIFERASE
31 TRCN0000072260 CAGAATCGTCGTATGCAGTGA pLKO.1 228 CDS 100% 2.640 N/A N/A LUCIFERASE
32 TRCN0000231714 CAGAATCGTCGTATGCAGTGA pLKO_TRC005 228 CDS 100% 2.640 N/A N/A LUCIFERASE
33 TRCN0000072243 CTTCGAAATGTCCGTTCGGTT pLKO.1 168 CDS 100% 2.640 N/A N/A LUCIFERASE
34 TRCN0000231693 CTTCGAAATGTCCGTTCGGTT pLKO_TRC005 168 CDS 100% 2.640 N/A N/A LUCIFERASE
35 TRCN0000072266 GAATGTTTACTACACTCGGAT pLKO.1 743 CDS 100% 2.640 N/A N/A LUCIFERASE
36 TRCN0000231729 GAATGTTTACTACACTCGGAT pLKO_TRC005 743 CDS 100% 2.640 N/A N/A LUCIFERASE
37 TRCN0000072251 GAGTACTTCGAAATGTCCGTT pLKO.1 163 CDS 100% 2.640 N/A N/A LUCIFERASE
38 TRCN0000231728 GAGTACTTCGAAATGTCCGTT pLKO_TRC005 163 CDS 100% 2.640 N/A N/A LUCIFERASE
39 TRCN0000072264 GCTGAGTACTTCGAAATGTCC pLKO.1 160 CDS 100% 2.640 N/A N/A LUCIFERASE
40 TRCN0000231741 GCTGAGTACTTCGAAATGTCC pLKO_TRC005 160 CDS 100% 2.640 N/A N/A LUCIFERASE
41 TRCN0000072245 TCACAGAATCGTCGTATGCAG pLKO.1 225 CDS 100% 2.640 N/A N/A LUCIFERASE
42 TRCN0000231697 TCACAGAATCGTCGTATGCAG pLKO_TRC005 225 CDS 100% 2.640 N/A N/A LUCIFERASE
43 TRCN0000072263 AGTACTTCGAAATGTCCGTTC pLKO.1 164 CDS 100% 2.250 N/A N/A LUCIFERASE
44 TRCN0000231739 AGTACTTCGAAATGTCCGTTC pLKO_TRC005 164 CDS 100% 2.250 N/A N/A LUCIFERASE
45 TRCN0000072249 GCGGTTGCCAAGAGGTTCCAT pLKO.1 976 CDS 100% 1.000 N/A N/A LUCIFERASE
46 TRCN0000231719 GCGGTTGCCAAGAGGTTCCAT pLKO_TRC005 976 CDS 100% 1.000 N/A N/A LUCIFERASE
47 TRCN0000072267 GCGCCATTCTATCCGCTGGAA pLKO.1 34 CDS 100% 0.880 N/A N/A LUCIFERASE
48 TRCN0000231731 GCGCCATTCTATCCGCTGGAA pLKO_TRC005 34 CDS 100% 0.880 N/A N/A LUCIFERASE
49 TRCN0000072257 TGAGTACTTCGAAATGTCCGT pLKO.1 162 CDS 100% 0.660 N/A N/A LUCIFERASE
50 TRCN0000231740 TGAGTACTTCGAAATGTCCGT pLKO_TRC005 162 CDS 100% 0.660 N/A N/A LUCIFERASE
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript Luciferase.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

shRNA Candidate Sequences

Show high scoring hairpin designs for this transcript.

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464768 pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
2 ccsbBroad301_99992 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
3 ccsbBroad301_99993 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
4 ccsbBroad301_99991 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
5 ccsbBroad301_99982 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
6 ccsbBroad304_99991 pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
7 ccsbBroad304_99992 pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
8 BRDN0000559440 pLX_TRC307 0% 99.8% 99.8% V5 1651_1653delTTG
9 BRDN0000464779 pLX_TRC302 0% 99.8% 99.8% V5 1651_1653delTTG
10 BRDN0000556282 pLX_TRC303 0% 99.8% 99.8% None 1651_1653delTTG
11 BRDN0000556262 pLX_TRC305 0% 99.8% 99.8% None 1651_1653delTTG
12 BRDN0000556299 pLX_TRC306 0% 99.8% 99.8% V5 1651_1653delTTG
13 BRDN0000556280 pLXI_TRC401 0% 99.8% 99.8% None 1651_1653delTTG
14 BRDN0000556275 pLXI_TRC402 0% 99.8% 99.8% HA 1651_1653delTTG
15 BRDN0000556301 pLX_TRC311 0% 99.8% 99.8% V5 1651_1653delTTG
16 BRDN0000556296 pLX_TRC312 0% 99.8% 99.8% V5 1651_1653delTTG
17 BRDN0000556302 pLX_TRC313 0% 99.8% 99.8% V5 1651_1653delTTG
18 BRDN0000556293 pLX_TRC314 0% 99.8% 99.8% V5 1651_1653delTTG
19 BRDN0000556270 pLX_TRC315 0% 99.8% 99.8% V5 1651_1653delTTG
20 BRDN0000556289 pLXI_TRC403 0% 99.8% 99.8% V5 1651_1653delTTG
21 ccsbBroad304_99993 pLX_TRC304 44.2% 76.6% 56.4% V5 (not translated due to prior stop codon) (many diffs)
22 BRDN0000464769 pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
23 BRDN0000464770 pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
Download CSV