Transcript: Luciferase.1

Identifier:
Hahn Lab 
Description:
luciferase cloned from BD pTAL-luc
Taxon:
CONTROL
Gene:
Hahn Lab Luciferase
Length:
1653
CDS:
1..1653

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Luciferase.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072247 GAATCGTCGTATGCAGTGAAA pLKO.1 230 CDS 100% 4.950 N/A N/A LUCIFERASE
2 TRCN0000231720 GAATCGTCGTATGCAGTGAAA pLKO_TRC005 230 CDS 100% 4.950 N/A N/A LUCIFERASE
3 TRCN0000072255 TCTACTGGTCTGCCTAAAGGT pLKO.1 601 CDS 100% 3.000 N/A N/A LUCIFERASE
4 TRCN0000231734 TCTACTGGTCTGCCTAAAGGT pLKO_TRC005 601 CDS 100% 3.000 N/A N/A LUCIFERASE
5 TRCN0000072251 GAGTACTTCGAAATGTCCGTT pLKO.1 163 CDS 100% 2.640 N/A N/A LUCIFERASE
6 TRCN0000231728 GAGTACTTCGAAATGTCCGTT pLKO_TRC005 163 CDS 100% 2.640 N/A N/A LUCIFERASE
7 TRCN0000072264 GCTGAGTACTTCGAAATGTCC pLKO.1 160 CDS 100% 2.640 N/A N/A LUCIFERASE
8 TRCN0000231741 GCTGAGTACTTCGAAATGTCC pLKO_TRC005 160 CDS 100% 2.640 N/A N/A LUCIFERASE
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript Luciferase.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

shRNA Candidate Sequences

Show high scoring hairpin designs for this transcript.

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464768 pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
2 ccsbBroad301_99992 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
3 ccsbBroad301_99993 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
4 ccsbBroad301_99991 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
5 ccsbBroad301_99982 pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
6 ccsbBroad304_99991 pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
7 ccsbBroad304_99992 pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
8 BRDN0000559440 pLX_TRC307 0% 99.8% 99.8% V5 1651_1653delTTG
9 BRDN0000464779 pLX_TRC302 0% 99.8% 99.8% V5 1651_1653delTTG
10 BRDN0000556282 pLX_TRC303 0% 99.8% 99.8% None 1651_1653delTTG
11 BRDN0000556262 pLX_TRC305 0% 99.8% 99.8% None 1651_1653delTTG
12 BRDN0000556299 pLX_TRC306 0% 99.8% 99.8% V5 1651_1653delTTG
13 BRDN0000556280 pLXI_TRC401 0% 99.8% 99.8% None 1651_1653delTTG
14 BRDN0000556275 pLXI_TRC402 0% 99.8% 99.8% HA 1651_1653delTTG
15 BRDN0000556301 pLX_TRC311 0% 99.8% 99.8% V5 1651_1653delTTG
16 BRDN0000556296 pLX_TRC312 0% 99.8% 99.8% V5 1651_1653delTTG
17 BRDN0000556302 pLX_TRC313 0% 99.8% 99.8% V5 1651_1653delTTG
18 BRDN0000556293 pLX_TRC314 0% 99.8% 99.8% V5 1651_1653delTTG
19 BRDN0000556270 pLX_TRC315 0% 99.8% 99.8% V5 1651_1653delTTG
20 BRDN0000556289 pLXI_TRC403 0% 99.8% 99.8% V5 1651_1653delTTG
21 ccsbBroad304_99993 pLX_TRC304 44.2% 76.6% 56.4% V5 (not translated due to prior stop codon) (many diffs)
22 BRDN0000464769 pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
23 BRDN0000464770 pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
Download CSV