Transcript: LacZ.1

Ecoli lacZ bGal reporter gene

Taxon:
Control
Gene:
LacZ (-42)
Length:
3207
CDS:
1..3207

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to LacZ.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072236 CCAACGTGACCTATCCCATTA pLKO.1 290 CDS 100% 10.800 N/A N/A lacZ
2 TRCN0000231735 CCAACGTGACCTATCCCATTA pLKO_TRC005 290 CDS 100% 10.800 N/A N/A lacZ
3 TRCN0000072242 GTCGGCTTACGGCGGTGATTT pLKO.1 1743 CDS 100% 4.400 N/A N/A lacZ
4 TRCN0000231706 GTCGGCTTACGGCGGTGATTT pLKO_TRC005 1743 CDS 100% 4.400 N/A N/A lacZ
5 TRCN0000072238 GTTCCGTCATAGCGATAACGA pLKO.1 1917 CDS 100% 3.000 N/A N/A lacZ
6 TRCN0000231685 GTTCCGTCATAGCGATAACGA pLKO_TRC005 1917 CDS 100% 3.000 N/A N/A lacZ
7 TRCN0000072226 CGATCGTAATCACCCGAGTGT pLKO.1 1326 CDS 100% 2.640 N/A N/A lacZ
8 TRCN0000231709 CGATCGTAATCACCCGAGTGT pLKO_TRC005 1326 CDS 100% 2.640 N/A N/A lacZ
9 TRCN0000072231 CGCTAAATACTGGCAGGCGTT pLKO.1 1635 CDS 100% 2.160 N/A N/A lacZ
10 TRCN0000231710 CGCTAAATACTGGCAGGCGTT pLKO_TRC005 1635 CDS 100% 2.160 N/A N/A lacZ
11 TRCN0000072229 GCGATCGTAATCACCCGAGTG pLKO.1 1325 CDS 100% 0.750 N/A N/A lacZ
12 TRCN0000231712 GCGATCGTAATCACCCGAGTG pLKO_TRC005 1325 CDS 100% 0.750 N/A N/A lacZ
13 TRCN0000072224 CGCGATCGTAATCACCCGAGT pLKO.1 1324 CDS 100% 0.720 N/A N/A lacZ
14 TRCN0000231722 CGCGATCGTAATCACCCGAGT pLKO_TRC005 1324 CDS 100% 0.720 N/A N/A lacZ
15 TRCN0000072241 GCGTTGGCAATTTAACCGCCA pLKO.1 2250 CDS 100% 0.540 N/A N/A lacZ
16 TRCN0000231704 GCGTTGGCAATTTAACCGCCA pLKO_TRC005 2250 CDS 100% 0.540 N/A N/A lacZ
17 TRCN0000072223 TGTTCGCATTATCCGAACCAT pLKO.1 1153 CDS 100% 0.300 N/A N/A lacZ
18 TRCN0000231726 TGTTCGCATTATCCGAACCAT pLKO_TRC005 1153 CDS 100% 0.300 N/A N/A lacZ
19 TRCN0000072230 CCCGTCAGTATCGGCGGAATT pLKO.1 2988 CDS 100% 0.000 N/A N/A lacZ
20 TRCN0000231711 CCCGTCAGTATCGGCGGAATT pLKO_TRC005 2988 CDS 100% 0.000 N/A N/A lacZ
21 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT pLKO.1 801 CDS 100% 0.000 N/A N/A lacZ
22 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT pLKO_TRC005 801 CDS 100% 0.000 N/A N/A lacZ
23 TRCN0000072227 GCGCTAATCACGACGCGCTGT pLKO.1 1382 CDS 100% 0.000 N/A N/A lacZ
24 TRCN0000231708 GCGCTAATCACGACGCGCTGT pLKO_TRC005 1382 CDS 100% 0.000 N/A N/A lacZ
25 TRCN0000072235 CCGTCATAGCGATAACGAGTT pLKO.1 1920 CDS 100% 4.050 N/A N/A lacZ
26 TRCN0000231738 CCGTCATAGCGATAACGAGTT pLKO_TRC005 1920 CDS 100% 4.050 N/A N/A lacZ
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript LacZ.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

shRNA Candidate Sequences

Show high scoring hairpin designs for this transcript.

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464771 pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99994 pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99995 pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99996 pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99983 pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99994 pLX_TRC304 3.4% 100% 100% V5 N/A
7 ccsbBroad304_99996 pLX_TRC304 3.4% 100% 100% V5 N/A
8 ccsbBroad304_99995 pLX_TRC304 3.4% 100% 100% V5 N/A
9 BRDN0000559441 pLX_TRC307 0% 100% 100% V5 N/A
10 BRDN0000464780 pLX_TRC302 0% 100% 100% V5 N/A
11 BRDN0000556272 pLX_TRC303 0% 100% 100% None N/A
12 BRDN0000556278 pLX_TRC305 0% 100% 100% None N/A
13 BRDN0000556288 pLX_TRC306 0% 100% 100% V5 N/A
14 BRDN0000556266 pLXI_TRC401 0% 100% 100% None N/A
15 BRDN0000556290 pLXI_TRC402 0% 100% 100% HA N/A
16 BRDN0000556291 pLX_TRC311 0% 100% 100% V5 N/A
17 BRDN0000556274 pLX_TRC312 0% 100% 100% V5 N/A
18 BRDN0000556300 pLX_TRC313 0% 100% 100% V5 N/A
19 BRDN0000556279 pLX_TRC314 0% 100% 100% V5 N/A
20 BRDN0000556294 pLX_TRC315 0% 100% 100% V5 N/A
21 BRDN0000556277 pLXI_TRC403 0% 100% 100% V5 N/A
22 BRDN0000464772 pDONR223 0% 100% 100% None N/A
23 BRDN0000464773 pDONR223 0% 100% 100% None N/A
Download CSV