Transcript: LacZ.1

Identifier:
Hahn Lab LacZ.1
Name:
(n/a)
Description:
Ecoli lacZ bGal reporter gene
Gene:
Hahn Lab LacZ
Taxon:
CONTROL
Length:
3207
CDS Start:
0
CDS End:
3206

Hairpins designed to target this transcript.

No results found.

All "non-targeting" hairpins matching this transcript

This list includes shRNAs that perfectly or closely match the queried transcript, but that were originally designed to target something other than the queried transcript. For example, this list can include shRNAs that were originally designed to target: (i) different isoforms or obsolete versions of the queried transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000072223 TGTTCGCATTATCCGAACCAT CONTROL -15 lacZ pLKO.1 1168 CDS 100% 100% 0.300 N/A
2 TRCN0000072224 CGCGATCGTAATCACCCGAGT CONTROL -15 lacZ pLKO.1 1339 CDS 100% 100% 0.720 N/A
3 TRCN0000072226 CGATCGTAATCACCCGAGTGT CONTROL -15 lacZ pLKO.1 1341 CDS 100% 100% 2.640 N/A
4 TRCN0000072227 GCGCTAATCACGACGCGCTGT CONTROL -15 lacZ pLKO.1 1397 CDS 100% 100% 0.000 N/A
5 TRCN0000072229 GCGATCGTAATCACCCGAGTG CONTROL -15 lacZ pLKO.1 1340 CDS 100% 100% 0.750 N/A
6 TRCN0000072230 CCCGTCAGTATCGGCGGAATT CONTROL -15 lacZ pLKO.1 3003 CDS 100% 100% 0.000 N/A
7 TRCN0000072231 CGCTAAATACTGGCAGGCGTT CONTROL -15 lacZ pLKO.1 1650 CDS 100% 100% 2.160 N/A
8 TRCN0000072236 CCAACGTGACCTATCCCATTA CONTROL -15 lacZ pLKO.1 305 CDS 100% 100% 10.800 N/A
9 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT CONTROL -15 lacZ pLKO.1 816 CDS 100% 100% 0.000 N/A
10 TRCN0000072238 GTTCCGTCATAGCGATAACGA CONTROL -15 lacZ pLKO.1 1932 CDS 100% 100% 3.000 N/A
11 TRCN0000072241 GCGTTGGCAATTTAACCGCCA CONTROL -15 lacZ pLKO.1 2265 CDS 100% 100% 0.540 N/A
12 TRCN0000072242 GTCGGCTTACGGCGGTGATTT CONTROL -15 lacZ pLKO.1 1758 CDS 100% 100% 4.400 N/A
13 TRCN0000231726 TGTTCGCATTATCCGAACCAT CONTROL -15 lacZ pLKO_TRC005 1168 CDS 100% 100% 0.300 N/A
14 TRCN0000231722 CGCGATCGTAATCACCCGAGT CONTROL -15 lacZ pLKO_TRC005 1339 CDS 100% 100% 0.720 N/A
15 TRCN0000231709 CGATCGTAATCACCCGAGTGT CONTROL -15 lacZ pLKO_TRC005 1341 CDS 100% 100% 2.640 N/A
16 TRCN0000231708 GCGCTAATCACGACGCGCTGT CONTROL -15 lacZ pLKO_TRC005 1397 CDS 100% 100% 0.000 N/A
17 TRCN0000231712 GCGATCGTAATCACCCGAGTG CONTROL -15 lacZ pLKO_TRC005 1340 CDS 100% 100% 0.750 N/A
18 TRCN0000231711 CCCGTCAGTATCGGCGGAATT CONTROL -15 lacZ pLKO_TRC005 3003 CDS 100% 100% 0.000 N/A
19 TRCN0000231710 CGCTAAATACTGGCAGGCGTT CONTROL -15 lacZ pLKO_TRC005 1650 CDS 100% 100% 2.160 N/A
20 TRCN0000231735 CCAACGTGACCTATCCCATTA CONTROL -15 lacZ pLKO_TRC005 305 CDS 100% 100% 10.800 N/A
21 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT CONTROL -15 lacZ pLKO_TRC005 816 CDS 100% 100% 0.000 N/A
22 TRCN0000231685 GTTCCGTCATAGCGATAACGA CONTROL -15 lacZ pLKO_TRC005 1932 CDS 100% 100% 3.000 N/A
23 TRCN0000231704 GCGTTGGCAATTTAACCGCCA CONTROL -15 lacZ pLKO_TRC005 2265 CDS 100% 100% 0.540 N/A
24 TRCN0000231706 GTCGGCTTACGGCGGTGATTT CONTROL -15 lacZ pLKO_TRC005 1758 CDS 100% 100% 4.400 N/A
25 TRCN0000072235 CCGTCATAGCGATAACGAGTT CONTROL -15 lacZ pLKO.1 1935 CDS 95% 100% 4.050 N/A
26 TRCN0000231738 CCGTCATAGCGATAACGAGTT CONTROL -15 lacZ pLKO_TRC005 1935 CDS 95% 100% 4.050 N/A
27 TRCN0000072232 CGTCGTATTACAACGTCGTGA CONTROL -15 lacZ pLKO.1 27 CDS 95% 94% N/A N/A
28 TRCN0000072240 TCGTATTACAACGTCGTGACT CONTROL -15 lacZ pLKO.1 29 CDS 95% 94% N/A N/A
29 TRCN0000231717 CGTCGTATTACAACGTCGTGA CONTROL -15 lacZ pLKO_TRC005 27 CDS 95% 94% N/A N/A
30 TRCN0000231702 TCGTATTACAACGTCGTGACT CONTROL -15 lacZ pLKO_TRC005 29 CDS 95% 94% N/A N/A
31 TRCN0000072225 CTCTGGCTAACGGTACGCGTA CONTROL -15 lacZ pLKO.1 2083 CDS 90% 89% N/A N/A
32 TRCN0000072228 ACTCTGGCTAACGGTACGCGT CONTROL -15 lacZ pLKO.1 2082 CDS 90% 89% N/A N/A
33 TRCN0000072233 CGACCACGCAAATCAGCGATT CONTROL -15 lacZ pLKO.1 656 CDS 90% 89% N/A N/A
34 TRCN0000072239 GCCGTCGTATTACAACGTCGT CONTROL -15 lacZ pLKO.1 25 CDS 90% 89% N/A N/A
35 TRCN0000231713 ACTCTGGCTAACGGTACGCGT CONTROL -15 lacZ pLKO_TRC005 2082 CDS 90% 89% N/A N/A
36 TRCN0000231716 CGACCACGCAAATCAGCGATT CONTROL -15 lacZ pLKO_TRC005 656 CDS 90% 89% N/A N/A
37 TRCN0000231700 GCCGTCGTATTACAACGTCGT CONTROL -15 lacZ pLKO_TRC005 25 CDS 90% 89% N/A N/A
38 TRCN0000072201 GTCGAGCTGGACGGCGACGTA CONTROL -10 GFP pLKO.1 49 CDS 73% 80% N/A N/A
39 TRCN0000156104 CCAACTTAATGGCTTGCAGTA human 10282 BET1 pLKO.1 549 3UTR 86% 90% N/A N/A
40 TRCN0000063939 CCGCTGGATCTGCCACTGTTT human 9253 NUMBL pLKO.1 710 CDS 81% 90% N/A N/A
41 TRCN0000056879 CGGCTTGCTTTCACAGATGTT human 4599 MX1 pLKO.1 1786 CDS 85% 89% N/A N/A
42 TRCN0000013367 GCGCTGAATTGCATTATGGAA human 9139 CBFA2T2 pLKO.1 1582 CDS 80% 89% N/A N/A
43 TRCN0000046251 GTGGATGAAGATCCAACCCAA human 2879 GPX4 pLKO.1 515 CDS 80% 89% N/A N/A
44 TRCN0000133673 GAATACCTGAAACTGTGGATT human 83640 FAM103A1 pLKO.1 717 3UTR 80% 89% N/A N/A
45 TRCN0000300410 GTGGATGAAGATCCAACCCAA human 2879 GPX4 pLKO_TRC005 542 CDS 80% 89% N/A N/A
46 TRCN0000057086 GCGTGGAGATGACCACGCCCT human 3543 IGLL1 pLKO.1 594 CDS 86% 85% N/A N/A
47 TRCN0000155936 CTTGCTGGATGAGCAGAACAA human 55954 ZMAT5 pLKO.1 277 CDS 86% 85% N/A N/A
48 TRCN0000172611 GCAGAAGAAGACAATGGCTGA human 79140 CCDC28B pLKO.1 577 CDS 86% 85% N/A N/A
49 TRCN0000319227 CTTGCTGGATGAGCAGAACAA human 55954 ZMAT5 pLKO_TRC005 277 CDS 86% 85% N/A N/A
50 TRCN0000296270 CAGTCAAGCAGCAAGATGGAG human 84316 LSMD1 pLKO_TRC005 506 CDS 82% 85% N/A N/A
51 TRCN0000033807 GCCTGCTTGTACAAATGGTTT human 26046 LTN1 pLKO.1 5328 CDS 81% 85% N/A N/A
52 TRCN0000038597 GAGGCTTCTCTCACAGATGTT human 162515 SLC16A11 pLKO.1 370 CDS 81% 85% N/A N/A
53 TRCN0000045809 GCTAGATCCAAATCTTCGATA human 9791 PTDSS1 pLKO.1 498 CDS 81% 85% N/A N/A
54 TRCN0000107216 CGCCGTGAAAGCTGGTGGAAT human 1611 DAP pLKO.1 210 CDS 81% 85% N/A N/A
55 TRCN0000158349 CGGCAGCTGATGTGAAGAATA human 65082 VPS33A pLKO.1 277 CDS 81% 85% N/A N/A
56 TRCN0000337008 CCTTCCTGCTGGTGCAGTATT human 8303 SNN pLKO_TRC005 357 CDS 81% 85% N/A N/A
57 TRCN0000338732 AGCGGACTTTCCGTGACATTT human 23731 TMEM245 pLKO_TRC005 2623 CDS 81% 85% N/A N/A
58 TRCN0000290942 GCTAGATCCAAATCTTCGATA human 9791 PTDSS1 pLKO_TRC005 498 CDS 81% 85% N/A N/A
59 TRCN0000322808 CCACTTGTTCCCACGAGAATA human 55968 NSFL1C pLKO_TRC005 2431 3UTR 81% 85% N/A N/A
60 TRCN0000417704 GGTGGTTAAAGCCATATTGGA human 8926 SNURF pLKO_TRC005 334 CDS 81% 85% N/A N/A
61 TRCN0000424848 GCCAGGGTCGAATCTGGAATG human 60598 KCNK15 pLKO_TRC005 1071 3UTR 81% 85% N/A N/A
62 TRCN0000061484 CGATGTACTCACGCTGGATAT human 9244 CRLF1 pLKO.1 869 CDS 77% 85% N/A N/A
63 TRCN0000136987 CTTGAGAAAGATGGCTACACA human 389383 CLPSL2 pLKO.1 231 CDS 77% 85% N/A N/A
64 TRCN0000139061 CAGGACTATGTGCAGATGAAG human 797 CALCB pLKO.1 236 CDS 77% 85% N/A N/A
65 TRCN0000157404 GATTGTGGAGACGGCTTCTAT human 254956 MORN5 pLKO.1 426 CDS 77% 85% N/A N/A
66 TRCN0000219668 CAGTGGTCGAATGGCATTAAG human 83942 TSSK1B pLKO.1 625 CDS 77% 85% N/A N/A
67 TRCN0000139358 CAGTTGATGAGCTGCTTGAGA human 400934 FLJ44385 pLKO.1 1529 CDS 77% 85% N/A N/A
68 TRCN0000236362 TCTGCCAGCTGGGCAAGTATA human 5916 RARG pLKO_TRC005 1096 CDS 77% 85% N/A N/A
69 TRCN0000246278 CTGCTGATGAGAAGTACAAAC human 388389 CCDC103 pLKO_TRC005 145 CDS 77% 85% N/A N/A
70 TRCN0000299639 CGATGTACTCACGCTGGATAT human 9244 CRLF1 pLKO_TRC005 860 CDS 77% 85% N/A N/A
71 TRCN0000440976 GAGATGATCGATGAGGTGGAC human 7134 TNNC1 pLKO_TRC005 201 CDS 77% 85% N/A N/A
72 TRCN0000445541 CCATGTTCCACTCGCTCTTTG human 51399 TRAPPC4 pLKO_TRC005 603 CDS 77% 85% N/A N/A
73 TRCN0000429060 CAAGCCCTTGTGATTCGAAAT human 476 ATP1A1 pLKO_TRC005 841 CDS 77% 85% N/A N/A
74 TRCN0000106981 CTACCATTCCAGCGTCTGGTA human 8968 HIST1H3F pLKO.1 198 CDS 79% 81% N/A N/A
75 TRCN0000165969 GCAACTGAGAAACAGCCAGAT human 440313 LOC440313 pLKO.1 2836 3UTR 75% 81% N/A N/A
76 TRCN0000038615 GAAGAAGCTCAGGCTGAAATT human 9550 ATP6V1G1 pLKO.1 205 CDS 78% 80% N/A N/A
77 TRCN0000083640 CGTTACCATTGGCTGGTCTTA human 54840 APTX pLKO.1 677 CDS 78% 80% N/A N/A
78 TRCN0000118023 CAGTGCTGATCTTCCAGGCCT human 10410 IFITM3 pLKO.1 611 CDS 78% 80% N/A N/A
79 TRCN0000135792 CCTGGTGAGAAGAGAACATTT human 79608 RIC3 pLKO.1 1601 3UTR 78% 80% N/A N/A
80 TRCN0000129528 GCCATCTTGCACTCAGAAGAT human 119032 C10orf32 pLKO.1 213 CDS 78% 80% N/A N/A
81 TRCN0000146377 CGTTCTTGACAAATGGGTGAA human 64083 GOLPH3 pLKO.1 945 CDS 78% 80% N/A N/A
82 TRCN0000155165 GCCACTGTTGAAACCACCATT human 22998 LIMCH1 pLKO.1 1555 CDS 78% 80% N/A N/A
83 TRCN0000263719 CATGTTCCCAGCTCGTTAATA human 113444 C1orf212 pLKO_TRC005 1321 3UTR 78% 80% N/A N/A
84 TRCN0000273315 ATGTGGGATGAGACGGAATTG human 29128 UHRF1 pLKO_TRC005 708 CDS 78% 80% N/A N/A
85 TRCN0000327872 GAAGAAGCTCAGGCTGAAATT human 9550 ATP6V1G1 pLKO_TRC005 237 CDS 78% 80% N/A N/A
86 TRCN0000344327 GCCACTGTTGAAACCACCATT human 22998 LIMCH1 pLKO_TRC005 1555 CDS 78% 80% N/A N/A
87 TRCN0000047494 CGGCAGAACATTGCTTATGAA human 10788 IQGAP2 pLKO.1 319 CDS 73% 80% N/A N/A
88 TRCN0000051292 CTGTGCTGAACGGACCGCTAT human 978 CDA pLKO.1 309 CDS 73% 80% N/A N/A
89 TRCN0000063752 GCTGCGGAAGAAGAGGCCATA human 2055 CLN8 pLKO.1 1074 CDS 73% 80% N/A N/A
90 TRCN0000135728 CCGTTGATCTTAGTGGTGAAA human 51105 PHF20L1 pLKO.1 2337 3UTR 73% 80% N/A N/A
91 TRCN0000142646 GCTGGAATCCTCTTCCTGAAA human 29075 HSPC072 pLKO.1 567 CDS 73% 80% N/A N/A
92 TRCN0000195604 CAGTACCAGTGTTTGGTGTTT human 558 AXL pLKO.1 798 CDS 73% 80% N/A N/A
93 TRCN0000122565 CGGCTGAAGGTCATGTGCGAA human 339745 SPOPL pLKO.1 460 CDS 73% 80% N/A N/A
94 TRCN0000245668 GCCGCTCATCAACACCTACAT human 126003 TRAPPC5 pLKO_TRC005 524 CDS 73% 80% N/A N/A
95 TRCN0000282829 CCAAGAAGGCACATCTGAAAC human 143379 C10orf82 pLKO_TRC005 486 CDS 73% 80% N/A N/A
96 TRCN0000053190 CCCAACTATTGCCGCAGCAAA human 55718 POLR3E pLKO.1 355 CDS 76% 78% N/A N/A
97 TRCN0000158264 CCTGCTGGAAGACAAGAACTT human 255101 CCDC108 pLKO.1 2956 CDS 79% 77% N/A N/A
98 TRCN0000373067 TGAGCTGAAGAGTGAGGATAT human 4340 MOG pLKO_TRC005 1168 3UTR 79% 77% N/A N/A
99 TRCN0000369769 CCTTCGGGTACATTCTCTATG human 89944 GLB1L2 pLKO_TRC005 1468 CDS 79% 77% N/A N/A
100 TRCN0000061987 CAAATGGATGAAATACGGTTA human 946 SIGLEC6 pLKO.1 537 CDS 75% 77% N/A N/A
101 TRCN0000155722 CGATACACAGAATCGCCAGAT human 6616 SNAP25 pLKO.1 725 CDS 75% 77% N/A N/A
102 TRCN0000204211 CATGGTGGTATGGCTGAACAA human 51537 MTFP1 pLKO.1 1111 3UTR 75% 77% N/A N/A
103 TRCN0000242115 CCCAATATCGCAGACCGATTA human 284615 ANKRD34A pLKO_TRC005 1501 CDS 75% 77% N/A N/A
104 TRCN0000343625 CGATACACAGAATCGCCAGAT human 6616 SNAP25 pLKO_TRC005 725 CDS 75% 77% N/A N/A
105 TRCN0000055897 CCTGGCGGAAATCAGTGTATT human 2200 FBN1 pLKO.1 356 CDS 70% 77% N/A N/A
106 TRCN0000141887 GATGAATGACTCCAGGAAGAA human 797 CALCB pLKO.1 461 3UTR 70% 77% N/A N/A
107 TRCN0000142526 GTTCTGAAGAACTCTGGCCAA human 257000 PLAC2 pLKO.1 1158 3UTR 70% 77% N/A N/A
108 TRCN0000286663 CCTGGCGGAAATCAGTGTATT human 2200 FBN1 pLKO_TRC005 551 CDS 70% 77% N/A N/A
109 TRCN0000036702 TCTGGGAAACTGGCGTGACAA human 401897 LOC401897 pLKO.1 375 CDS 70% 77% N/A N/A
110 TRCN0000008642 CCTTGCCCGCTCGGGTATGAA human 6208 RPS14 pLKO.1 410 CDS 76% 73% N/A N/A
111 TRCN0000277903 CCTTGCCCGCTCGGGTATGAA human 6208 RPS14 pLKO_TRC005 410 CDS 76% 73% N/A N/A
112 TRCN0000418344 CACACACCACCACCGTATTAT human 222484 LNX2 pLKO_TRC005 1636 CDS 76% 73% N/A N/A
113 TRCN0000052698 GCCATGTCAGTTTATACCTTA human 51205 ACP6 pLKO.1 1645 CDS 68% 73% N/A N/A
114 TRCN0000121821 GATGAAGACAACTTGAACTAT human 139425 DCAF8L1 pLKO.1 1712 CDS 68% 73% N/A N/A
115 TRCN0000289154 GCCATGTCAGTTTATACCTTA human 51205 ACP6 pLKO_TRC005 1665 CDS 68% 73% N/A N/A
116 TRCN0000027859 CGACTTCCTGTTCAACATCTT mouse 14747 Cmklr1 pLKO.1 510 CDS 85% 94% N/A N/A
117 TRCN0000322397 AGATGTGGATGGCGAGAAATA mouse 66230 Mrps28 pLKO_TRC005 405 CDS 86% 90% N/A N/A
118 TRCN0000023297 CGCTGCCAAGACGGTGAAGTT mouse 14182 Fgfr1 pLKO.1 564 CDS 85% 89% N/A N/A
119 TRCN0000436725 CAACTGCTGACGCAGCTTCTT mouse 50518 a pLKO_TRC005 469 CDS 80% 89% N/A N/A
120 TRCN0000279373 TTCACCCATCACCGCTGATAA mouse 105203 BC016423 pLKO_TRC005 3565 CDS 86% 85% N/A N/A
121 TRCN0000338054 GCCGTTGTTCCCACGAATAAT mouse 17245 Mdm1 pLKO_TRC005 702 CDS 86% 85% N/A N/A
122 TRCN0000374404 CGCTGTACTCTGGAGCAAATC mouse 232944 Mark4 pLKO_TRC005 892 CDS 86% 85% N/A N/A
123 TRCN0000039524 GCTCACTTAAGGTTGATGATA mouse 66743 Rnf220 pLKO.1 874 CDS 82% 85% N/A N/A
124 TRCN0000026093 GCTGTGTCGTCTGGTCAAATA mouse 18430 Oxtr pLKO.1 330 CDS 81% 85% N/A N/A
125 TRCN0000124665 GCTTCCTTTCAAGATCGTGGT mouse 18203 Ntan1 pLKO.1 651 CDS 81% 85% N/A N/A
126 TRCN0000251674 TACTAGCAGATGCAGGTTATG mouse 70166 Lipn pLKO_TRC005 553 CDS 81% 85% N/A N/A
127 TRCN0000312286 GCTTCCTTTCAAGATCGTGGT mouse 18203 Ntan1 pLKO_TRC005 653 CDS 81% 85% N/A N/A
128 TRCN0000437524 CCACTCAGCTTTCAGATGATG mouse 216150 Cdc34 pLKO_TRC005 1112 3UTR 81% 85% N/A N/A
129 TRCN0000031806 TGCCATGTCAGCCAGTATAAT mouse 16613 Klk1b11 pLKO.1 222 CDS 78% 85% N/A N/A
130 TRCN0000098399 GTGTGATCATTGGTTGCAGCA mouse 70831 Krtap31-1 pLKO.1 449 CDS 77% 85% N/A N/A
131 TRCN0000126111 GCATCCGCCATTGTAGACAAT mouse 74775 Lmbr1l pLKO.1 692 CDS 77% 85% N/A N/A
132 TRCN0000179007 CGAAGGACATTGTTGCAGTAT mouse 225523 Cep120 pLKO.1 585 CDS 77% 85% N/A N/A
133 TRCN0000173359 GAACTTCCTTACTACCGCATA mouse 381886 Mrgpra6 pLKO.1 486 CDS 77% 85% N/A N/A
134 TRCN0000248466 ACCCGAGATGTATCATCTAAG mouse 57896 Krcc1 pLKO_TRC005 1070 CDS 77% 85% N/A N/A
135 TRCN0000311572 CAAGCCCTTGTGATTCGAAAT mouse 11928 Atp1a1 pLKO_TRC005 754 CDS 77% 85% N/A N/A
136 TRCN0000376957 GAAGATGGTGCTGGTATCCAC mouse 170759 Atp13a1 pLKO_TRC005 3625 3UTR 77% 85% N/A N/A
137 TRCN0000041158 CCACTCTTAATGTGATTTCTT mouse 51902 Rnf24 pLKO.1 2782 3UTR 76% 82% N/A N/A
138 TRCN0000124181 GCTGATCCTTTACTACGCCTT mouse 58239 Dexi pLKO.1 465 CDS 75% 81% N/A N/A
139 TRCN0000302503 GCTGATCCTTTACTACGCCTT mouse 58239 Dexi pLKO_TRC005 478 CDS 75% 81% N/A N/A
140 TRCN0000091308 CCTGCATTTACCACCAGGAAA mouse 434902 LOC434902 pLKO.1 194 CDS 82% 80% N/A N/A
141 TRCN0000328195 CATCAGGGAAGCCTTACTTAT mouse 113853 Vmn1r53 pLKO_TRC005 570 CDS 82% 80% N/A N/A
142 TRCN0000030801 GCATGGTACAAGATGGATGAT mouse 13532 Usp17l5 pLKO.1 974 CDS 78% 80% N/A N/A
143 TRCN0000221440 CCAAGGCATGTGCAACGAATA mouse 30800 Mmp20 pLKO.1 1181 CDS 78% 80% N/A N/A
144 TRCN0000182727 GCCATCTTACACTCGGAAGAT mouse 66439 2010012O05Rik pLKO.1 223 CDS 78% 80% N/A N/A
145 TRCN0000244260 GGATTGAGCAGTGGGTCAAAG mouse 108143 Taf9 pLKO_TRC005 560 CDS 78% 80% N/A N/A
146 TRCN0000281839 TCTGATAAGCGACCAACTTAA mouse 80902 Zfp202 pLKO_TRC005 2475 3UTR 78% 80% N/A N/A
147 TRCN0000366062 GACTGGAAACCCTGACTTTAT mouse 18746 Pkm2 pLKO_TRC005 1861 3UTR 78% 80% N/A N/A
148 TRCN0000375474 CGTCATGATAGGAGACGATTG mouse 76987 Hdhd2 pLKO_TRC005 678 CDS 78% 80% N/A N/A
149 TRCN0000067771 CCAGCAGGTCTTTACCAGTAT mouse 14130 Fcgr2b pLKO.1 674 CDS 73% 80% N/A N/A
150 TRCN0000114175 GCGAATCTGTTCCCTTATAAA mouse 67895 Ppa1 pLKO.1 352 CDS 73% 80% N/A N/A
151 TRCN0000179866 CCACAAGAAATATCCCGAGAA mouse 70208 Med23 pLKO.1 2833 CDS 73% 80% N/A N/A
152 TRCN0000238608 CCAACAGCAACTGGGAAATAT mouse 229571 Gm4858 pLKO_TRC005 953 3UTR 73% 80% N/A N/A
153 TRCN0000247394 TAGTCACCACTGTGATCATTG mouse 245532 Awat2 pLKO_TRC005 110 CDS 73% 80% N/A N/A
154 TRCN0000313993 ACGAAGAGGCCCACCGATTAT mouse 69072 Ebna1bp2 pLKO_TRC005 504 CDS 73% 80% N/A N/A
155 TRCN0000313550 AGAAGCCCGTCGTCGGTTTAA mouse 19155 Npepps pLKO_TRC005 2290 CDS 73% 80% N/A N/A
156 TRCN0000341854 CCACAAGAAATATCCCGAGAA mouse 70208 Med23 pLKO_TRC005 2833 CDS 73% 80% N/A N/A
157 TRCN0000309313 GCGAATCTGTTCCCTTATAAA mouse 67895 Ppa1 pLKO_TRC005 351 CDS 73% 80% N/A N/A
158 TRCN0000089399 GCAGTGGTTGATGAACACCAA mouse 14526 Gcg pLKO.1 326 CDS 73% 80% N/A N/A
159 TRCN0000222640 GCCAGTCTGATGAAGGTTCAA mouse 26565 Pla2g10 pLKO.1 793 3UTR 73% 80% N/A N/A
160 TRCN0000075939 CCCTTCAACATTGCCAGCTAT mouse 22171 Tyms pLKO.1 687 CDS 72% 78% N/A N/A
161 TRCN0000112364 CTGGAAGTGAAGAGATGTGTA mouse 114895 Psbpc1 pLKO.1 187 CDS 72% 78% N/A N/A
162 TRCN0000317508 CCCTTCAACATTGCCAGCTAT mouse 22171 Tyms pLKO_TRC005 686 CDS 72% 78% N/A N/A
163 TRCN0000240117 ATCAGCTACATCAAGCAACTG mouse 67341 Ascl4 pLKO_TRC005 358 CDS 79% 77% N/A N/A
164 TRCN0000082310 GCCAGGATCTTCTGCCGTCTT mouse 231991 Creb5 pLKO.1 166 CDS 75% 77% N/A N/A
165 TRCN0000093104 GCTGCTGGAAGAGAATAACTA mouse 76653 Cby3 pLKO.1 774 CDS 75% 77% N/A N/A
166 TRCN0000111370 AGCTGAAAGAAGCGTTGCTTA mouse 20022 Polr2j pLKO.1 372 3UTR 75% 77% N/A N/A
167 TRCN0000111587 CCAGTTCAAGATCGGTCTGAT mouse 56433 Vps29 pLKO.1 295 CDS 75% 77% N/A N/A
168 TRCN0000332516 AGCTGAAAGAAGCGTTGCTTA mouse 20022 Polr2j pLKO_TRC005 418 3UTR 75% 77% N/A N/A
169 TRCN0000097274 GCTGGGATGATCAAGCCATTT mouse 18783 Pla2g4a pLKO.1 2415 3UTR 70% 77% N/A N/A
170 TRCN0000102925 GCTGCCATTAGAGATGTATTT mouse 108043 Chrnb3 pLKO.1 1722 3UTR 70% 77% N/A N/A
171 TRCN0000104248 TGGTGCATCTCTTGCTGATAT mouse 68193 Rpl24 pLKO.1 291 CDS 70% 77% N/A N/A
172 TRCN0000108917 TCTGCCAACTACCGAGCCTAT mouse 21954 Tnni3 pLKO.1 198 CDS 70% 77% N/A N/A
173 TRCN0000111559 GCTGATGAACAGAGCCTTGTT mouse 65114 Vps35 pLKO.1 1518 CDS 70% 77% N/A N/A
174 TRCN0000193931 CCATCATCCTTATGGTCAGTA mouse 231549 Lrrc8d pLKO.1 925 CDS 70% 77% N/A N/A
175 TRCN0000318221 GCTGATGAACAGAGCCTTGTT mouse 65114 Vps35 pLKO_TRC005 1493 CDS 70% 77% N/A N/A
176 TRCN0000335307 GCTGGGATGATCAAGCCATTT mouse 18783 Pla2g4a pLKO_TRC005 2415 3UTR 70% 77% N/A N/A
177 TRCN0000126101 CCTACAGGAAAGACGCAGAAT mouse 58866 Treh pLKO.1 880 CDS 76% 73% N/A N/A
178 TRCN0000127431 CACCACACAATCAATTTCCAT mouse 231986 Jazf1 pLKO.1 699 CDS 76% 73% N/A N/A
179 TRCN0000366470 TGAACAGCAAGTCCGTGATTC mouse 18969 Pola2 pLKO_TRC005 1096 CDS 76% 73% N/A N/A
180 TRCN0000419127 TGCAGGAACAGACCCGATTAT mouse 104175 Sbk1 pLKO_TRC005 2195 3UTR 76% 73% N/A N/A
181 TRCN0000267961 GACAGGAAAGAAGCGAATTAC mouse 68736 1110034B05Rik pLKO_TRC005 726 CDS 72% 73% N/A N/A
182 TRCN0000104401 GCACGGATACATTGGTGAATT mouse 267019 Rps15a pLKO.1 146 CDS 68% 73% N/A N/A
183 TRCN0000374491 TGCAACCGGAACCGCATTGAG mouse 329731 Fam19a3 pLKO_TRC005 749 CDS 68% 73% N/A N/A
184 TRCN0000420061 AGATCTGGTCAGAATGTATTG mouse 74245 Ctbs pLKO_TRC005 602 CDS 66% 72% N/A N/A
Download CSV

All hairpins matching this transcript

(this is the union of the above two tables, provided here as a single download link)

Download CSV

Hairpin Candidate Sequences

Show high scoring hairpin designs for this transcript.

ORFs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464771 pDONR223 0% 99.9% 99.9% None 3205_3207delTTG
2 ccsbBroad301_99994 pLX_TRC301 0% 99.9% 99.9% None 3205_3207delTTG
3 ccsbBroad301_99995 pLX_TRC301 0% 99.9% 99.9% None 3205_3207delTTG
4 ccsbBroad301_99996 pLX_TRC301 0% 99.9% 99.9% None 3205_3207delTTG
5 ccsbBroad301_99983 pLX_TRC301 0% 99.9% 99.9% None 3205_3207delTTG
6 ccsbBroad304_99994 pLX_TRC304 3.4% 99.9% 99.9% V5 3205_3207delTTG
7 ccsbBroad304_99996 pLX_TRC304 3.4% 99.9% 99.9% V5 3205_3207delTTG
8 ccsbBroad304_99995 pLX_TRC304 3.4% 99.9% 99.9% V5 3205_3207delTTG
9 BRDN0000559441 pLX_TRC307 0% 99.9% 99.9% V5 3205_3207delTTG
10 BRDN0000464780 pLX_TRC302 0% 99.9% 99.9% V5 3205_3207delTTG
11 BRDN0000556272 pLX_TRC303 0% 99.9% 99.9% None 3205_3207delTTG
12 BRDN0000556278 pLX_TRC305 0% 99.9% 99.9% None 3205_3207delTTG
13 BRDN0000556288 pLX_TRC306 0% 99.9% 99.9% V5 3205_3207delTTG
14 BRDN0000556266 pLXI_TRC401 0% 99.9% 99.9% None 3205_3207delTTG
15 BRDN0000556290 pLXI_TRC402 0% 99.9% 99.9% HA 3205_3207delTTG
16 BRDN0000556291 pLX_TRC311 0% 99.9% 99.9% V5 3205_3207delTTG
17 BRDN0000556274 pLX_TRC312 0% 99.9% 99.9% V5 3205_3207delTTG
18 BRDN0000556300 pLX_TRC313 0% 99.9% 99.9% V5 3205_3207delTTG
19 BRDN0000556279 pLX_TRC314 0% 99.9% 99.9% V5 3205_3207delTTG
20 BRDN0000556294 pLX_TRC315 0% 99.9% 99.9% V5 3205_3207delTTG
21 BRDN0000556277 pLXI_TRC403 0% 99.9% 99.9% V5 3205_3207delTTG
22 BRDN0000464772 pDONR223 0% 99.9% 99.9% None 3205_3207delTTG
23 BRDN0000464773 pDONR223 0% 99.9% 99.9% None 3205_3207delTTG
Download CSV