Transcript: HcRed.1

Identifier:
Hahn Lab HcRed.1
Name:
(n/a)
Description:
far-red fluorescent protein
Gene:
Hahn Lab HcRed
Taxon:
CONTROL
Length:
687
CDS Start:
0
CDS End:
686

Hairpins designed to target this transcript.

No results found.

All "non-targeting" hairpins matching this transcript

This list includes shRNAs that perfectly or closely match the queried transcript, but that were originally designed to target something other than the queried transcript. For example, this list can include shRNAs that were originally designed to target: (i) different isoforms or obsolete versions of the queried transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000072205 GCTCCGTGAACGGCCACGAGT CONTROL -12 RFP pLKO.1 59 CDS 85% 89% N/A N/A
2 TRCN0000231703 GCTCCGTGAACGGCCACGAGT CONTROL -12 RFP pLKO_TRC005 59 CDS 85% 89% N/A N/A
3 TRCN0000180582 GCTGAAGAAGAAGGAGGAGAA human 10814 CPLX2 pLKO.1 558 CDS 85% 89% N/A N/A
4 TRCN0000072598 ACTCCTGCAAGTGCGAGGGAT human 4504 MT3 pLKO.1 289 CDS 80% 89% N/A N/A
5 TRCN0000083072 GTGATGAAGGAACAAGAGGAT human 1302 COL11A2 pLKO.1 3325 CDS 80% 89% N/A N/A
6 TRCN0000232556 GCGGAGAGGAAGACGAGTATT human 90864 SPSB3 pLKO_TRC005 378 CDS 82% 85% N/A N/A
7 TRCN0000143019 CTTCTTCAACAAGCTTGCCTT human 138724 C9orf131 pLKO.1 710 CDS 78% 85% N/A N/A
8 TRCN0000013867 CAACTACTTCAGTGCGATGTA human 1999 ELF3 pLKO.1 3226 CDS 77% 85% N/A N/A
9 TRCN0000020365 GCATGAAGAGTACATGAAGAA human 55251 PCMTD2 pLKO.1 643 CDS 77% 85% N/A N/A
10 TRCN0000116373 CCCAGGCATGAAGAATCTATA human 51174 TUBD1 pLKO.1 615 CDS 77% 85% N/A N/A
11 TRCN0000122673 GCATCTGACCAAGCCCACCTT human 79701 C17orf101 pLKO.1 710 CDS 77% 85% N/A N/A
12 TRCN0000449804 CATCAGCTCCGGCAAGAAGAA human 51523 CXXC5 pLKO_TRC005 1046 CDS 75% 81% N/A N/A
13 TRCN0000199357 CCTGCGTCCATCACCGACATG human 169436 C9orf96 pLKO.1 1007 CDS 78% 80% N/A N/A
14 TRCN0000139499 CCCTGAGATGAAGAAAGAGCT human 54867 TMEM214 pLKO.1 1095 CDS 78% 80% N/A N/A
15 TRCN0000235498 GAGCGCAAGCCATGATCTATA human 8925 HERC1 pLKO_TRC005 7920 CDS 78% 80% N/A N/A
16 TRCN0000274839 CCGATGCCGGAACAAGAAGAA human 122953 JDP2 pLKO_TRC005 534 CDS 78% 80% N/A N/A
17 TRCN0000294421 GACACCACTGGAGGGTGACTT human 1026 CDKN1A pLKO_TRC005 290 CDS 78% 80% N/A N/A
18 TRCN0000051104 GCCACTACCAAGGGCGAGTAA human 80332 ADAM33 pLKO.1 428 CDS 73% 80% N/A N/A
19 TRCN0000151630 GAAGAATGAAGTGCTTCGATT human 84816 RTN4IP1 pLKO.1 428 CDS 73% 80% N/A N/A
20 TRCN0000140509 GCTTCCATCTCAGACATCCTT human 159013 CXorf38 pLKO.1 1013 3UTR 73% 80% N/A N/A
21 TRCN0000413407 TACAAGGAGGTGACGACACTG human 27338 UBE2S pLKO_TRC005 417 CDS 72% 78% N/A N/A
22 TRCN0000017845 CAGCCTGAAAGCAACTCTGAT human 58500 ZNF250 pLKO.1 1563 CDS 79% 77% N/A N/A
23 TRCN0000119056 CGAGAACTTCAAGTACGAGGA human 57716 PRX pLKO.1 485 CDS 75% 77% N/A N/A
24 TRCN0000369148 CCAGTTCACTGTCCGGCTCAA human 256302 C17orf103 pLKO_TRC005 86 CDS 75% 77% N/A N/A
25 TRCN0000055486 CTGCCTACTGAAGAGTATGAA human 54681 P4HTM pLKO.1 869 CDS 70% 77% N/A N/A
26 TRCN0000200177 CTGCGGAAGAAGAAGAAGGTA mouse 18100 Mrpl40 pLKO.1 262 CDS 80% 89% N/A N/A
27 TRCN0000081977 CAGATGCCGGAACAAGAAGAA mouse 81703 Jdp2 pLKO.1 492 CDS 82% 85% N/A N/A
28 TRCN0000112579 GAAGAAGAAGACGCCTACTTT mouse 239157 Pnma2 pLKO.1 1422 CDS 81% 85% N/A N/A
29 TRCN0000115109 GATGCTGCTAAGAAGGAGGAA mouse 12889 Cplx1 pLKO.1 202 CDS 81% 85% N/A N/A
30 TRCN0000192370 CGGAAGAGAAGGAAGAATATT mouse 171463 Il17rd pLKO.1 516 CDS 81% 85% N/A N/A
31 TRCN0000040810 CCCAAGAAGAAGGAGAGTAAA mouse 22194 Ube2e1 pLKO.1 277 CDS 77% 85% N/A N/A
32 TRCN0000100473 CCAGCTAACCAGACAAGAAAT mouse 50527 Ero1l pLKO.1 1324 CDS 77% 85% N/A N/A
33 TRCN0000302688 CCAGCTAACCAGACAAGAAAT mouse 50527 Ero1l pLKO_TRC005 1324 CDS 77% 85% N/A N/A
34 TRCN0000023976 GAAGGCAAGTATCGAGCTGAT mouse 22115 Tssk2 pLKO.1 892 CDS 75% 81% N/A N/A
35 TRCN0000086915 CCCGACTTCCAAGAAGAGGAT mouse 78688 Nol3 pLKO.1 795 CDS 78% 80% N/A N/A
36 TRCN0000182412 GCAGAAGACGAAGGAAGTACA mouse 331532 Tceal5 pLKO.1 233 CDS 78% 80% N/A N/A
37 TRCN0000175841 GAAGCAGAAACTGAGTACTCA mouse 20420 Shd pLKO.1 568 CDS 73% 80% N/A N/A
38 TRCN0000095637 GATGTACGAAGAGCACCTGAA mouse 66332 1700018B24Rik pLKO.1 143 CDS 79% 77% N/A N/A
39 TRCN0000098022 GAAGAAGAACTACTGCGAGTT mouse 319922 Vwc2 pLKO.1 768 CDS 75% 77% N/A N/A
40 TRCN0000096871 CGGCAGAGGATTCGTAAACTT mouse 140488 Igf2bp3 pLKO.1 471 CDS 70% 77% N/A N/A
41 TRCN0000430577 AGGAGAGTCCATGCCAAGATG mouse 73218 3110056O03Rik pLKO_TRC005 2220 3UTR 76% 73% N/A N/A
42 TRCN0000076312 CTGACGGAAGTGATCCTGAAA mouse 66590 Farsa pLKO.1 504 CDS 72% 73% N/A N/A
43 TRCN0000287495 CTGACGGAAGTGATCCTGAAA mouse 66590 Farsa pLKO_TRC005 542 CDS 72% 73% N/A N/A
Download CSV

All hairpins matching this transcript

(this is the union of the above two tables, provided here as a single download link)

Download CSV

Hairpin Candidate Sequences

Show high scoring hairpin designs for this transcript.

ORFs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464765 pDONR223 0% 99.5% 99.5% None 685_687delTTG
2 ccsbBroad301_99990 pLX_TRC301 0% 99.5% 99.5% None 685_687delTTG
3 ccsbBroad301_99981 pLX_TRC301 0% 99.5% 99.5% None 685_687delTTG
4 ccsbBroad301_99989 pLX_TRC301 0% 99.5% 99.5% None 685_687delTTG
5 ccsbBroad301_99988 pLX_TRC301 0% 99.5% 99.5% None 685_687delTTG
6 ccsbBroad304_99990 pLX_TRC304 75.8% 99.5% 99.5% V5 685_687delTTG
7 BRDN0000559442 pLX_TRC307 0% 99.5% 99.5% V5 685_687delTTG
8 BRDN0000464778 pLX_TRC302 0% 99.5% 99.5% V5 685_687delTTG
9 BRDN0000556267 pLX_TRC303 0% 99.5% 99.5% None 685_687delTTG
10 BRDN0000556265 pLX_TRC305 0% 99.5% 99.5% None 685_687delTTG
11 BRDN0000556269 pLX_TRC306 0% 99.5% 99.5% V5 685_687delTTG
12 BRDN0000556261 pLXI_TRC401 0% 99.5% 99.5% None 685_687delTTG
13 BRDN0000556287 pLXI_TRC402 0% 99.5% 99.5% HA 685_687delTTG
14 BRDN0000556264 pLX_TRC311 0% 99.5% 99.5% V5 685_687delTTG
15 BRDN0000556295 pLX_TRC312 0% 99.5% 99.5% V5 685_687delTTG
16 BRDN0000556268 pLX_TRC313 0% 99.5% 99.5% V5 685_687delTTG
17 BRDN0000556263 pLX_TRC314 0% 99.5% 99.5% V5 685_687delTTG
18 BRDN0000556284 pLX_TRC315 0% 99.5% 99.5% V5 685_687delTTG
19 BRDN0000556260 pLXI_TRC403 0% 99.5% 99.5% V5 685_687delTTG
20 ccsbBroad304_99988 pLX_TRC304 76.9% 69.8% 41.1% V5 (not translated due to prior stop codon) (many diffs)
21 BRDN0000464766 pDONR223 0% 99.5% 99.5% None 685_687delTTG
22 BRDN0000464767 pDONR223 0% 99.5% 99.5% None 685_687delTTG
Download CSV