Transcript: BFP.1

Hahn Lab blue fluorescent protein


shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to BFP.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072178 CAACAGCCACAACGTCTATAT pLKO.1 438 CDS 100% 13.200 N/A N/A GFP
2 TRCN0000231750 CAACAGCCACAACGTCTATAT pLKO_TRC005 438 CDS 100% 13.200 N/A N/A GFP
5 TRCN0000072194 CCACATGAAGCAGCACGACTT pLKO.1 231 CDS 100% 4.050 N/A N/A GFP
7 TRCN0000072180 CTATATCATGGCCGACAAGCA pLKO.1 453 CDS 100% 2.640 N/A N/A GFP
9 TRCN0000072199 TGACCCTGAAGTTCATCTGCA pLKO.1 128 CDS 100% 2.640 N/A N/A GFP
10 TRCN0000231745 TGACCCTGAAGTTCATCTGCA pLKO_TRC005 128 CDS 100% 2.640 N/A N/A GFP
11 TRCN0000072196 ACGTCTATATCATGGCCGACA pLKO.1 449 CDS 100% 2.160 N/A N/A GFP
12 TRCN0000231756 ACGTCTATATCATGGCCGACA pLKO_TRC005 449 CDS 100% 2.160 N/A N/A GFP
13 TRCN0000072183 CGGCATGGACGAGCTGTACAA pLKO.1 696 CDS 100% 1.650 N/A N/A GFP
14 TRCN0000231751 CGGCATGGACGAGCTGTACAA pLKO_TRC005 696 CDS 100% 1.650 N/A N/A GFP
15 TRCN0000072195 GCGACGTAAACGGCCACAAGT pLKO.1 62 CDS 100% 1.650 N/A N/A GFP
17 TRCN0000072197 CTACGGCAAGCTGACCCTGAA pLKO.1 117 CDS 100% 1.350 N/A N/A GFP
18 TRCN0000231757 CTACGGCAAGCTGACCCTGAA pLKO_TRC005 117 CDS 100% 1.350 N/A N/A GFP
19 TRCN0000072182 TCTCGGCATGGACGAGCTGTA pLKO.1 693 CDS 100% 1.350 N/A N/A GFP
20 TRCN0000231752 TCTCGGCATGGACGAGCTGTA pLKO_TRC005 693 CDS 100% 1.350 N/A N/A GFP
21 TRCN0000072179 CGACCACATGAAGCAGCACGA pLKO.1 228 CDS 100% 0.720 N/A N/A GFP
22 TRCN0000231749 CGACCACATGAAGCAGCACGA pLKO_TRC005 228 CDS 100% 0.720 N/A N/A GFP
23 TRCN0000072190 GACCACATGAAGCAGCACGAC pLKO.1 229 CDS 100% 0.720 N/A N/A GFP
24 TRCN0000231759 GACCACATGAAGCAGCACGAC pLKO_TRC005 229 CDS 100% 0.720 N/A N/A GFP
25 TRCN0000206973 GCACGACTTCTTCAAGTCCGC pLKO.1 243 CDS 100% 0.018 N/A N/A GFP
26 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA pLKO.1 668 CDS 100% 0.000 N/A N/A GFP
27 TRCN0000072188 CCCGACCACATGAAGCAGCAC pLKO.1 226 CDS 100% 0.000 N/A N/A GFP
28 TRCN0000231763 CCCGACCACATGAAGCAGCAC pLKO_TRC005 226 CDS 100% 0.000 N/A N/A GFP
29 TRCN0000072184 CGGGATCACTCTCGGCATGGA pLKO.1 684 CDS 100% 0.000 N/A N/A GFP
30 TRCN0000231748 CGGGATCACTCTCGGCATGGA pLKO_TRC005 684 CDS 100% 0.000 N/A N/A GFP
31 TRCN0000072187 CTCTCGGCATGGACGAGCTGT pLKO.1 692 CDS 100% 0.000 N/A N/A GFP
32 TRCN0000231764 CTCTCGGCATGGACGAGCTGT pLKO_TRC005 692 CDS 100% 0.000 N/A N/A GFP
33 TRCN0000072202 GCCACAACATCGAGGACGGCA pLKO.1 506 CDS 100% 0.000 N/A N/A GFP
34 TRCN0000231705 GCCACAACATCGAGGACGGCA pLKO_TRC005 506 CDS 100% 0.000 N/A N/A GFP
35 TRCN0000207065 GCGATCACATGGTCCTGCTGG pLKO.1 647 CDS 100% 0.000 N/A N/A GFP
36 TRCN0000072198 GCGCGATCACATGGTCCTGCT pLKO.1 645 CDS 100% 0.000 N/A N/A GFP
37 TRCN0000231758 GCGCGATCACATGGTCCTGCT pLKO_TRC005 645 CDS 100% 0.000 N/A N/A GFP
38 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC pLKO.1 21 CDS 100% 0.000 N/A N/A GFP
39 TRCN0000072201 GTCGAGCTGGACGGCGACGTA pLKO.1 49 CDS 100% 0.000 N/A N/A GFP
40 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC pLKO.1 616 CDS 100% 0.000 N/A N/A GFP
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript BFP.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 BRDN0000464762 pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99986 pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99987 pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99980 pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99985 pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99986 pLX_TRC304 82.4% 100% 100% V5 N/A
7 BRDN0000464777 pLX_TRC302 0% 100% 100% V5 N/A
8 BRDN0000559460 TAGAGATTGGGTTCAACCTGGAAG pLX_TRC317 61.8% 100% 100% V5 N/A
9 ccsbBroad304_99985 pLX_TRC304 72.2% 99.8% 99.5% V5 (not translated due to prior stop codon) 716A>N
10 ccsbBroad304_99987 pLX_TRC304 88.7% 99.7% 23.8% V5 (not translated due to frame shift) 99delG;116delC
11 BRDN0000464763 pDONR223 0% 100% 100% None N/A
12 BRDN0000464764 pDONR223 0% 100% 100% None N/A
13 ccsbBroad301_99984 pLX_TRC301 0% 99.1% 98.3% None (many diffs)
14 ccsbBroad301_99999 pLX_TRC301 0% 99.1% 98.3% None (many diffs)
15 ccsbBroad301_99997 pLX_TRC301 0% 99.1% 98.3% None (many diffs)
16 ccsbBroad301_99998 pLX_TRC301 0% 99.1% 98.3% None (many diffs)
17 ccsbBroad304_99999 pLX_TRC304 72.2% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
18 ccsbBroad304_99998 pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
19 ccsbBroad304_99997 pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
20 BRDN0000559443 pLX_TRC307 0% 99.1% 98.3% V5 (many diffs)
21 BRDN0000464774 pDONR221 0% 99.1% 98.3% None (many diffs)
22 BRDN0000464781 pLX_TRC302 0% 99.1% 98.3% V5 (many diffs)
23 BRDN0000556273 pLX_TRC303 0% 99.1% 98.3% None (many diffs)
24 BRDN0000556285 pLX_TRC305 0% 99.1% 98.3% None (many diffs)
25 BRDN0000556297 pLX_TRC306 0% 99.1% 98.3% V5 (many diffs)
26 BRDN0000556276 pLXI_TRC401 0% 99.1% 98.3% None (many diffs)
27 BRDN0000556271 pLXI_TRC402 0% 99.1% 98.3% HA (many diffs)
28 BRDN0000556283 pLX_TRC311 0% 99.1% 98.3% V5 (many diffs)
29 BRDN0000556281 pLX_TRC313 0% 99.1% 98.3% V5 (many diffs)
30 BRDN0000556292 pLX_TRC314 0% 99.1% 98.3% V5 (many diffs)
31 BRDN0000556298 pLX_TRC315 0% 99.1% 98.3% V5 (many diffs)
32 BRDN0000556286 pLXI_TRC403 0% 99.1% 98.3% V5 (many diffs)
33 BRDN0000559466 ATCGATTTTGTATTTGGAGGCCCT pLX_TRC317 70% 99.1% 98.3% V5 (many diffs)
34 BRDN0000464775 pDONR221 0% 99.1% 98.3% None (many diffs)
35 BRDN0000464776 pDONR221 0% 99.1% 98.3% None (many diffs)
Download CSV