Transcript: BFP.1

Hahn Lab blue fluorescent protein

BFP (-40)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to BFP.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072178 CAACAGCCACAACGTCTATAT pLKO.1 438 CDS 100% 13.200 N/A N/A GFP
2 TRCN0000231750 CAACAGCCACAACGTCTATAT pLKO_TRC005 438 CDS 100% 13.200 N/A N/A GFP
5 TRCN0000072194 CCACATGAAGCAGCACGACTT pLKO.1 231 CDS 100% 4.050 N/A N/A GFP
7 TRCN0000072180 CTATATCATGGCCGACAAGCA pLKO.1 453 CDS 100% 2.640 N/A N/A GFP
9 TRCN0000072199 TGACCCTGAAGTTCATCTGCA pLKO.1 128 CDS 100% 2.640 N/A N/A GFP
10 TRCN0000231745 TGACCCTGAAGTTCATCTGCA pLKO_TRC005 128 CDS 100% 2.640 N/A N/A GFP
11 TRCN0000072196 ACGTCTATATCATGGCCGACA pLKO.1 449 CDS 100% 2.160 N/A N/A GFP
12 TRCN0000231756 ACGTCTATATCATGGCCGACA pLKO_TRC005 449 CDS 100% 2.160 N/A N/A GFP
13 TRCN0000072183 CGGCATGGACGAGCTGTACAA pLKO.1 696 CDS 100% 1.650 N/A N/A GFP
14 TRCN0000231751 CGGCATGGACGAGCTGTACAA pLKO_TRC005 696 CDS 100% 1.650 N/A N/A GFP
15 TRCN0000072195 GCGACGTAAACGGCCACAAGT pLKO.1 62 CDS 100% 1.650 N/A N/A GFP
17 TRCN0000072197 CTACGGCAAGCTGACCCTGAA pLKO.1 117 CDS 100% 1.350 N/A N/A GFP
18 TRCN0000231757 CTACGGCAAGCTGACCCTGAA pLKO_TRC005 117 CDS 100% 1.350 N/A N/A GFP
19 TRCN0000072182 TCTCGGCATGGACGAGCTGTA pLKO.1 693 CDS 100% 1.350 N/A N/A GFP
20 TRCN0000231752 TCTCGGCATGGACGAGCTGTA pLKO_TRC005 693 CDS 100% 1.350 N/A N/A GFP
21 TRCN0000072179 CGACCACATGAAGCAGCACGA pLKO.1 228 CDS 100% 0.720 N/A N/A GFP
22 TRCN0000231749 CGACCACATGAAGCAGCACGA pLKO_TRC005 228 CDS 100% 0.720 N/A N/A GFP
23 TRCN0000072190 GACCACATGAAGCAGCACGAC pLKO.1 229 CDS 100% 0.720 N/A N/A GFP
24 TRCN0000231759 GACCACATGAAGCAGCACGAC pLKO_TRC005 229 CDS 100% 0.720 N/A N/A GFP
25 TRCN0000206973 GCACGACTTCTTCAAGTCCGC pLKO.1 243 CDS 100% 0.018 N/A N/A GFP
26 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA pLKO.1 668 CDS 100% 0.000 N/A N/A GFP
27 TRCN0000072188 CCCGACCACATGAAGCAGCAC pLKO.1 226 CDS 100% 0.000 N/A N/A GFP
28 TRCN0000231763 CCCGACCACATGAAGCAGCAC pLKO_TRC005 226 CDS 100% 0.000 N/A N/A GFP
29 TRCN0000072184 CGGGATCACTCTCGGCATGGA pLKO.1 684 CDS 100% 0.000 N/A N/A GFP
30 TRCN0000231748 CGGGATCACTCTCGGCATGGA pLKO_TRC005 684 CDS 100% 0.000 N/A N/A GFP
31 TRCN0000072187 CTCTCGGCATGGACGAGCTGT pLKO.1 692 CDS 100% 0.000 N/A N/A GFP
32 TRCN0000231764 CTCTCGGCATGGACGAGCTGT pLKO_TRC005 692 CDS 100% 0.000 N/A N/A GFP
33 TRCN0000072202 GCCACAACATCGAGGACGGCA pLKO.1 506 CDS 100% 0.000 N/A N/A GFP
34 TRCN0000231705 GCCACAACATCGAGGACGGCA pLKO_TRC005 506 CDS 100% 0.000 N/A N/A GFP
35 TRCN0000207065 GCGATCACATGGTCCTGCTGG pLKO.1 647 CDS 100% 0.000 N/A N/A GFP
36 TRCN0000072198 GCGCGATCACATGGTCCTGCT pLKO.1 645 CDS 100% 0.000 N/A N/A GFP
37 TRCN0000231758 GCGCGATCACATGGTCCTGCT pLKO_TRC005 645 CDS 100% 0.000 N/A N/A GFP
38 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC pLKO.1 21 CDS 100% 0.000 N/A N/A GFP
39 TRCN0000072201 GTCGAGCTGGACGGCGACGTA pLKO.1 49 CDS 100% 0.000 N/A N/A GFP
40 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC pLKO.1 616 CDS 100% 0.000 N/A N/A GFP
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript BFP.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

shRNA Candidate Sequences

Show high scoring hairpin designs for this transcript.

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464762 pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99987 pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99985 pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99980 pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99986 pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99986 pLX_TRC304 82.4% 100% 100% V5 N/A
7 BRDN0000464777 pLX_TRC302 0% 100% 100% V5 N/A
8 ccsbBroad304_99985 pLX_TRC304 72.2% 99.8% 99.5% V5 (not translated due to prior stop codon) 716A>N
9 ccsbBroad304_99987 pLX_TRC304 88.7% 99.7% 23.8% V5 (not translated due to frame shift) 99delG;116delC
10 BRDN0000464763 pDONR223 0% 100% 100% None N/A
11 BRDN0000464764 pDONR223 0% 100% 100% None N/A
12 ccsbBroad301_99984 pLX_TRC301 0% 99.1% 98.3% None (many diffs)
13 ccsbBroad301_99999 pLX_TRC301 0% 99.1% 98.3% None (many diffs)
14 ccsbBroad301_99998 pLX_TRC301 0% 99.1% 98.3% None (many diffs)
15 ccsbBroad301_99997 pLX_TRC301 0% 99.1% 98.3% None (many diffs)
16 ccsbBroad304_99999 pLX_TRC304 72.2% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
17 ccsbBroad304_99998 pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
18 ccsbBroad304_99997 pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
19 BRDN0000559443 pLX_TRC307 0% 99.1% 98.3% V5 (many diffs)
20 BRDN0000464774 pDONR221 0% 99.1% 98.3% None (many diffs)
21 BRDN0000464781 pLX_TRC302 0% 99.1% 98.3% V5 (many diffs)
22 BRDN0000556273 pLX_TRC303 0% 99.1% 98.3% None (many diffs)
23 BRDN0000556285 pLX_TRC305 0% 99.1% 98.3% None (many diffs)
24 BRDN0000556297 pLX_TRC306 0% 99.1% 98.3% V5 (many diffs)
25 BRDN0000556276 pLXI_TRC401 0% 99.1% 98.3% None (many diffs)
26 BRDN0000556271 pLXI_TRC402 0% 99.1% 98.3% HA (many diffs)
27 BRDN0000556283 pLX_TRC311 0% 99.1% 98.3% V5 (many diffs)
28 BRDN0000556281 pLX_TRC313 0% 99.1% 98.3% V5 (many diffs)
29 BRDN0000556292 pLX_TRC314 0% 99.1% 98.3% V5 (many diffs)
30 BRDN0000556298 pLX_TRC315 0% 99.1% 98.3% V5 (many diffs)
31 BRDN0000556286 pLXI_TRC403 0% 99.1% 98.3% V5 (many diffs)
32 BRDN0000464775 pDONR221 0% 99.1% 98.3% None (many diffs)
33 BRDN0000464776 pDONR221 0% 99.1% 98.3% None (many diffs)
Download CSV