Design Hairpins to Target a Transcript Sequence

Scoring of candidate shRNA sequences available in 2 ways:

  1. If the desired transcript is listed in NCBI RefSeq, you can find hairpin designs by:
    • Searching for an NCBI gene or transcript here or selecting "Search by Gene" from the Navigation bar above
    • Clicking on the "Transcript ID" link on the Search Results page to navigate to the "Transcript Details" page
    • Under the "Hairpin Candidate Sequences" heading, clicking the link titled "Show high scoring hairpin designs for this transcript"

    This will yield a table of the top shRNA designs for this transcript, pre-scored for predicted knockdown efficacy and for specificity vs. other genes of the same taxon.

  2. If the desired target transcript is not found in NCBI RefSeq, or is from a taxon other than mouse or human (e.g. Rat) you can paste the sequence you wish to target in the box below (in DNA or RNA form), and receive a list of matching shRNA sequence designs, scored according to predicted knockdown efficacy. Note that specificity versus other targets not is not considered in this score.
Target transcript sequence (in DNA or RNA form):
e.g. 'ACGTATTGATGCCACAGACGTATTGATGCCACAGACGTATTGATGCCACAG', etc.