Plate: CTR01_CLO (shRNA)

TRC Shipment Quarter:
TRC1 Q7
Number of clones:
85
Number of unique genes:
4

Well Contents

Plate Well Clone ID Target Sequence Vector Notes
1 CTR01_CLO A01 TRCN0000072178 CAACAGCCACAACGTCTATAT pLKO.1
2 CTR01_CLO A02 TRCN0000072179 CGACCACATGAAGCAGCACGA pLKO.1
3 CTR01_CLO A03 TRCN0000072180 CTATATCATGGCCGACAAGCA pLKO.1
4 CTR01_CLO A04 TRCN0000072181 ACAACAGCCACAACGTCTATA pLKO.1
5 CTR01_CLO A05 TRCN0000072182 TCTCGGCATGGACGAGCTGTA pLKO.1
6 CTR01_CLO A06 TRCN0000072183 CGGCATGGACGAGCTGTACAA pLKO.1
7 CTR01_CLO A07 TRCN0000072184 CGGGATCACTCTCGGCATGGA pLKO.1
8 CTR01_CLO A08 TRCN0000072185 TACAACAGCCACAACGTCTAT pLKO.1
9 CTR01_CLO A09 TRCN0000072186 TGCCCGACAACCACTACCTGA pLKO.1
10 CTR01_CLO A10 TRCN0000072187 CTCTCGGCATGGACGAGCTGT pLKO.1
11 CTR01_CLO A11 TRCN0000072188 CCCGACCACATGAAGCAGCAC pLKO.1
12 CTR01_CLO A12 TRCN0000072189 CCTACGGCGTGCAGTGCTTCA pLKO.1
13 CTR01_CLO B01 TRCN0000072190 GACCACATGAAGCAGCACGAC pLKO.1
14 CTR01_CLO B03 TRCN0000072192 GAACGGCATCAAGGTGAACTT pLKO.1
15 CTR01_CLO B04 TRCN0000072193 CGACGTAAACGGCCACAAGTT pLKO.1
16 CTR01_CLO B05 TRCN0000072194 CCACATGAAGCAGCACGACTT pLKO.1
17 CTR01_CLO B06 TRCN0000072195 GCGACGTAAACGGCCACAAGT pLKO.1
18 CTR01_CLO B07 TRCN0000072196 ACGTCTATATCATGGCCGACA pLKO.1
19 CTR01_CLO B08 TRCN0000072197 CTACGGCAAGCTGACCCTGAA pLKO.1
20 CTR01_CLO B09 TRCN0000072198 GCGCGATCACATGGTCCTGCT pLKO.1
21 CTR01_CLO B10 TRCN0000072199 TGACCCTGAAGTTCATCTGCA pLKO.1
22 CTR01_CLO B11 TRCN0000072200 AGTACAACTACAACAGCCACA pLKO.1
23 CTR01_CLO B12 TRCN0000072201 GTCGAGCTGGACGGCGACGTA pLKO.1
24 CTR01_CLO C01 TRCN0000072202 GCCACAACATCGAGGACGGCA pLKO.1
25 CTR01_CLO C02 TRCN0000072203 CGCGTGATGAACTTCGAGGAC pLKO.1
26 CTR01_CLO C03 TRCN0000072204 TCAGTTCCAGTACGGCTCCAA pLKO.1
27 CTR01_CLO C04 TRCN0000072205 GCTCCGTGAACGGCCACGAGT pLKO.1
28 CTR01_CLO C05 TRCN0000072206 GTGGGAGCGCGTGATGAACTT pLKO.1
29 CTR01_CLO C07 TRCN0000072208 GCTTCAAGTGGGAGCGCGTGA pLKO.1
30 CTR01_CLO C08 TRCN0000072209 CTCAGTTCCAGTACGGCTCCA pLKO.1
31 CTR01_CLO C09 TRCN0000072210 CGTAATGCAGAAGAAGACCAT pLKO.1
32 CTR01_CLO C10 TRCN0000072211 CTACACCATCGTGGAACAGTA pLKO.1
33 CTR01_CLO C11 TRCN0000072212 CCGTAATGCAGAAGAAGACCA pLKO.1
34 CTR01_CLO C12 TRCN0000072213 ACTACACCATCGTGGAACAGT pLKO.1
35 CTR01_CLO D02 TRCN0000072215 GTAATGCAGAAGAAGACCATG pLKO.1
36 CTR01_CLO D03 TRCN0000072216 CCACTACGACGCCGAGGTCAA pLKO.1
37 CTR01_CLO D04 TRCN0000072217 CAACGAGGACTACACCATCGT pLKO.1
38 CTR01_CLO D05 TRCN0000072218 GAACGGCCACGAGTTCGAGAT pLKO.1
39 CTR01_CLO D06 TRCN0000072219 CTACAAGACCGACATCAAGCT pLKO.1
40 CTR01_CLO D08 TRCN0000072221 TGCAGAAGAAGACCATGGGCT pLKO.1
41 CTR01_CLO D10 TRCN0000072223 TGTTCGCATTATCCGAACCAT pLKO.1
42 CTR01_CLO D11 TRCN0000072224 CGCGATCGTAATCACCCGAGT pLKO.1
43 CTR01_CLO D12 TRCN0000072225 CTCTGGCTAACGGTACGCGTA pLKO.1
44 CTR01_CLO E01 TRCN0000072226 CGATCGTAATCACCCGAGTGT pLKO.1
45 CTR01_CLO E02 TRCN0000072227 GCGCTAATCACGACGCGCTGT pLKO.1
46 CTR01_CLO E03 TRCN0000072228 ACTCTGGCTAACGGTACGCGT pLKO.1
47 CTR01_CLO E04 TRCN0000072229 GCGATCGTAATCACCCGAGTG pLKO.1
48 CTR01_CLO E05 TRCN0000072230 CCCGTCAGTATCGGCGGAATT pLKO.1
49 CTR01_CLO E06 TRCN0000072231 CGCTAAATACTGGCAGGCGTT pLKO.1
50 CTR01_CLO E07 TRCN0000072232 CGTCGTATTACAACGTCGTGA pLKO.1
51 CTR01_CLO E08 TRCN0000072233 CGACCACGCAAATCAGCGATT pLKO.1
52 CTR01_CLO E09 TRCN0000072234 CGGATTCTCTGGCCGTCGTAT pLKO.1
53 CTR01_CLO E10 TRCN0000072235 CCGTCATAGCGATAACGAGTT pLKO.1
54 CTR01_CLO E11 TRCN0000072236 CCAACGTGACCTATCCCATTA pLKO.1
55 CTR01_CLO E12 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT pLKO.1
56 CTR01_CLO F01 TRCN0000072238 GTTCCGTCATAGCGATAACGA pLKO.1
57 CTR01_CLO F02 TRCN0000072239 GCCGTCGTATTACAACGTCGT pLKO.1
58 CTR01_CLO F03 TRCN0000072240 TCGTATTACAACGTCGTGACT pLKO.1
59 CTR01_CLO F04 TRCN0000072241 GCGTTGGCAATTTAACCGCCA pLKO.1
60 CTR01_CLO F05 TRCN0000072242 GTCGGCTTACGGCGGTGATTT pLKO.1
61 CTR01_CLO F06 TRCN0000072243 CTTCGAAATGTCCGTTCGGTT pLKO.1
62 CTR01_CLO F07 TRCN0000072244 ATCACAGAATCGTCGTATGCA pLKO.1
63 CTR01_CLO F08 TRCN0000072245 TCACAGAATCGTCGTATGCAG pLKO.1
64 CTR01_CLO F09 TRCN0000072246 CAAATCACAGAATCGTCGTAT pLKO.1
65 CTR01_CLO F10 TRCN0000072247 GAATCGTCGTATGCAGTGAAA pLKO.1
66 CTR01_CLO F11 TRCN0000072248 AGTCAAGTAACAACCGCGAAA pLKO.1
67 CTR01_CLO F12 TRCN0000072249 GCGGTTGCCAAGAGGTTCCAT pLKO.1
68 CTR01_CLO G01 TRCN0000072250 AGAATCGTCGTATGCAGTGAA pLKO.1
69 CTR01_CLO G02 TRCN0000072251 GAGTACTTCGAAATGTCCGTT pLKO.1
70 CTR01_CLO G03 TRCN0000072252 ACTTACGCTGAGTACTTCGAA pLKO.1
71 CTR01_CLO G04 TRCN0000072253 ACACTCGGATATTTGATATGT pLKO.1
72 CTR01_CLO G05 TRCN0000072254 ATGTTTACTACACTCGGATAT pLKO.1
73 CTR01_CLO G06 TRCN0000072255 TCTACTGGTCTGCCTAAAGGT pLKO.1
74 CTR01_CLO G07 TRCN0000072256 ACGCTGAGTACTTCGAAATGT pLKO.1
75 CTR01_CLO G08 TRCN0000072257 TGAGTACTTCGAAATGTCCGT pLKO.1
76 CTR01_CLO G09 TRCN0000072258 TGTCCGGTTATGTAAACAATC pLKO.1
77 CTR01_CLO G10 TRCN0000072259 CGCTGAGTACTTCGAAATGTC pLKO.1
78 CTR01_CLO G11 TRCN0000072260 CAGAATCGTCGTATGCAGTGA pLKO.1
79 CTR01_CLO G12 TRCN0000072261 CACTCGGATATTTGATATGTG pLKO.1
80 CTR01_CLO H01 TRCN0000072262 CACTTACGCTGAGTACTTCGA pLKO.1
81 CTR01_CLO H02 TRCN0000072263 AGTACTTCGAAATGTCCGTTC pLKO.1
82 CTR01_CLO H03 TRCN0000072264 GCTGAGTACTTCGAAATGTCC pLKO.1
83 CTR01_CLO H04 TRCN0000072265 GTTGTGTTTGTGGACGAAGTA pLKO.1
84 CTR01_CLO H05 TRCN0000072266 GAATGTTTACTACACTCGGAT pLKO.1
85 CTR01_CLO H06 TRCN0000072267 GCGCCATTCTATCCGCTGGAA pLKO.1
Download CSV