Plate: CTR01_CLO (shRNA)

TRC Shipment Quarter:
TRC1 Q7
Number of clones:
85
Number of unique genes:
4

Well Contents

Plate Well Clone ID Target Sequence Target Taxon[?] Target Gene ID Target Gene Symbol Vector Target Transcript Match Position Match Region[?] Intrinsic Score[?] Adjusted Score[?] Notes
1 CTR01_CLO A01 TRCN0000072178 CAACAGCCACAACGTCTATAT (control) -10 GFP pLKO.1 clonetechGfp.1 438 CDS 13.200 N/A
2 CTR01_CLO A02 TRCN0000072179 CGACCACATGAAGCAGCACGA (control) -10 GFP pLKO.1 clonetechGfp.1 228 CDS 0.720 N/A
3 CTR01_CLO A03 TRCN0000072180 CTATATCATGGCCGACAAGCA (control) -10 GFP pLKO.1 clonetechGfp.1 453 CDS 2.640 N/A
4 CTR01_CLO A04 TRCN0000072181 ACAACAGCCACAACGTCTATA (control) -10 GFP pLKO.1 clonetechGfp.1 437 CDS 13.200 N/A
5 CTR01_CLO A05 TRCN0000072182 TCTCGGCATGGACGAGCTGTA (control) -10 GFP pLKO.1 clonetechGfp.1 693 CDS 1.350 N/A
6 CTR01_CLO A06 TRCN0000072183 CGGCATGGACGAGCTGTACAA (control) -10 GFP pLKO.1 clonetechGfp.1 696 CDS 1.650 N/A
7 CTR01_CLO A07 TRCN0000072184 CGGGATCACTCTCGGCATGGA (control) -10 GFP pLKO.1 clonetechGfp.1 684 CDS 0.000 N/A
8 CTR01_CLO A08 TRCN0000072185 TACAACAGCCACAACGTCTAT (control) -10 GFP pLKO.1 clonetechGfp.1 436 CDS 4.950 N/A
9 CTR01_CLO A09 TRCN0000072186 TGCCCGACAACCACTACCTGA (control) -10 GFP pLKO.1 clonetechGfp.1 587 CDS 0.880 N/A
10 CTR01_CLO A10 TRCN0000072187 CTCTCGGCATGGACGAGCTGT (control) -10 GFP pLKO.1 clonetechGfp.1 692 CDS 0.000 N/A
11 CTR01_CLO A11 TRCN0000072188 CCCGACCACATGAAGCAGCAC (control) -10 GFP pLKO.1 clonetechGfp.1 226 CDS 0.000 N/A
12 CTR01_CLO A12 TRCN0000072189 CCTACGGCGTGCAGTGCTTCA (control) -10 GFP pLKO.1 clonetechGfp.1 197 CDS 0.000 N/A
13 CTR01_CLO B01 TRCN0000072190 GACCACATGAAGCAGCACGAC (control) -10 GFP pLKO.1 clonetechGfp.1 229 CDS 0.720 N/A
14 CTR01_CLO B03 TRCN0000072192 GAACGGCATCAAGGTGAACTT (control) -10 GFP pLKO.1 clonetechGfp.1 477 CDS 4.950 N/A
15 CTR01_CLO B04 TRCN0000072193 CGACGTAAACGGCCACAAGTT (control) -10 GFP pLKO.1 clonetechGfp.1 63 CDS 4.950 N/A
16 CTR01_CLO B05 TRCN0000072194 CCACATGAAGCAGCACGACTT (control) -10 GFP pLKO.1 clonetechGfp.1 231 CDS 4.050 N/A
17 CTR01_CLO B06 TRCN0000072195 GCGACGTAAACGGCCACAAGT (control) -10 GFP pLKO.1 clonetechGfp.1 62 CDS 1.650 N/A
18 CTR01_CLO B07 TRCN0000072196 ACGTCTATATCATGGCCGACA (control) -10 GFP pLKO.1 clonetechGfp.1 449 CDS 2.160 N/A
19 CTR01_CLO B08 TRCN0000072197 CTACGGCAAGCTGACCCTGAA (control) -10 GFP pLKO.1 clonetechGfp.1 117 CDS 1.350 N/A
20 CTR01_CLO B09 TRCN0000072198 GCGCGATCACATGGTCCTGCT (control) -10 GFP pLKO.1 clonetechGfp.1 645 CDS 0.000 N/A
21 CTR01_CLO B10 TRCN0000072199 TGACCCTGAAGTTCATCTGCA (control) -10 GFP pLKO.1 clonetechGfp.1 128 CDS 2.640 N/A
22 CTR01_CLO B11 TRCN0000072200 AGTACAACTACAACAGCCACA (control) -10 GFP pLKO.1 clonetechGfp.1 428 CDS 2.160 N/A
23 CTR01_CLO B12 TRCN0000072201 GTCGAGCTGGACGGCGACGTA (control) -10 GFP pLKO.1 clonetechGfp.1 49 CDS 0.000 N/A
24 CTR01_CLO C01 TRCN0000072202 GCCACAACATCGAGGACGGCA (control) -10 GFP pLKO.1 clonetechGfp.1 506 CDS 0.000 N/A
25 CTR01_CLO C02 TRCN0000072203 CGCGTGATGAACTTCGAGGAC (control) -12 RFP pLKO.1 rfp.1 283 CDS 0.720 N/A
26 CTR01_CLO C03 TRCN0000072204 TCAGTTCCAGTACGGCTCCAA (control) -12 RFP pLKO.1 rfp.1 189 CDS 2.640 N/A
27 CTR01_CLO C04 TRCN0000072205 GCTCCGTGAACGGCCACGAGT (control) -12 RFP pLKO.1 rfp.1 59 CDS 0.000 N/A
28 CTR01_CLO C05 TRCN0000072206 GTGGGAGCGCGTGATGAACTT (control) -12 RFP pLKO.1 rfp.1 276 CDS 1.650 N/A
29 CTR01_CLO C07 TRCN0000072208 GCTTCAAGTGGGAGCGCGTGA (control) -12 RFP pLKO.1 rfp.1 269 CDS 0.000 N/A
30 CTR01_CLO C08 TRCN0000072209 CTCAGTTCCAGTACGGCTCCA (control) -12 RFP pLKO.1 rfp.1 188 CDS 0.720 N/A
31 CTR01_CLO C09 TRCN0000072210 CGTAATGCAGAAGAAGACCAT (control) -12 RFP pLKO.1 rfp.1 402 CDS 2.640 N/A
32 CTR01_CLO C10 TRCN0000072211 CTACACCATCGTGGAACAGTA (control) -12 RFP pLKO.1 rfp.1 621 CDS 4.950 N/A
33 CTR01_CLO C11 TRCN0000072212 CCGTAATGCAGAAGAAGACCA (control) -12 RFP pLKO.1 rfp.1 401 CDS 2.640 N/A
34 CTR01_CLO C12 TRCN0000072213 ACTACACCATCGTGGAACAGT (control) -12 RFP pLKO.1 rfp.1 620 CDS 3.000 N/A
35 CTR01_CLO D02 TRCN0000072215 GTAATGCAGAAGAAGACCATG (control) -12 RFP pLKO.1 rfp.1 403 CDS 4.050 N/A
36 CTR01_CLO D03 TRCN0000072216 CCACTACGACGCCGAGGTCAA (control) -12 RFP pLKO.1 rfp.1 513 CDS 0.000 N/A
37 CTR01_CLO D04 TRCN0000072217 CAACGAGGACTACACCATCGT (control) -12 RFP pLKO.1 rfp.1 612 CDS 2.640 N/A
38 CTR01_CLO D05 TRCN0000072218 GAACGGCCACGAGTTCGAGAT (control) -12 RFP pLKO.1 rfp.1 66 CDS 1.350 N/A
39 CTR01_CLO D06 TRCN0000072219 CTACAAGACCGACATCAAGCT (control) -12 RFP pLKO.1 rfp.1 576 CDS 2.640 N/A
40 CTR01_CLO D08 TRCN0000072221 TGCAGAAGAAGACCATGGGCT (control) -12 RFP pLKO.1 rfp.1 407 CDS 0.660 N/A
41 CTR01_CLO D10 TRCN0000072223 TGTTCGCATTATCCGAACCAT (control) -15 lacZ pLKO.1 lacZ.1 1168 CDS 0.300 N/A
42 CTR01_CLO D11 TRCN0000072224 CGCGATCGTAATCACCCGAGT (control) -15 lacZ pLKO.1 lacZ.1 1339 CDS 0.720 N/A
43 CTR01_CLO D12 TRCN0000072225 CTCTGGCTAACGGTACGCGTA (control) -15 lacZ pLKO.1 lacZ.1 2083 CDS 0.720 N/A
44 CTR01_CLO E01 TRCN0000072226 CGATCGTAATCACCCGAGTGT (control) -15 lacZ pLKO.1 lacZ.1 1341 CDS 2.640 N/A
45 CTR01_CLO E02 TRCN0000072227 GCGCTAATCACGACGCGCTGT (control) -15 lacZ pLKO.1 lacZ.1 1397 CDS 0.000 N/A
46 CTR01_CLO E03 TRCN0000072228 ACTCTGGCTAACGGTACGCGT (control) -15 lacZ pLKO.1 lacZ.1 2082 CDS 0.220 N/A
47 CTR01_CLO E04 TRCN0000072229 GCGATCGTAATCACCCGAGTG (control) -15 lacZ pLKO.1 lacZ.1 1340 CDS 0.750 N/A
48 CTR01_CLO E05 TRCN0000072230 CCCGTCAGTATCGGCGGAATT (control) -15 lacZ pLKO.1 lacZ.1 3003 CDS 0.000 N/A
49 CTR01_CLO E06 TRCN0000072231 CGCTAAATACTGGCAGGCGTT (control) -15 lacZ pLKO.1 lacZ.1 1650 CDS 2.160 N/A
50 CTR01_CLO E07 TRCN0000072232 CGTCGTATTACAACGTCGTGA (control) -15 lacZ pLKO.1 lacZ.1 27 CDS 2.640 N/A
51 CTR01_CLO E08 TRCN0000072233 CGACCACGCAAATCAGCGATT (control) -15 lacZ pLKO.1 lacZ.1 656 CDS 4.050 N/A
52 CTR01_CLO E09 TRCN0000072234 CGGATTCTCTGGCCGTCGTAT (control) -15 lacZ pLKO.1 lacZ.1 14 CDS 1.650 N/A
53 CTR01_CLO E10 TRCN0000072235 CCGTCATAGCGATAACGAGTT (control) -15 lacZ pLKO.1 lacZ.1 1935 CDS 4.050 N/A
54 CTR01_CLO E11 TRCN0000072236 CCAACGTGACCTATCCCATTA (control) -15 lacZ pLKO.1 lacZ.1 305 CDS 10.800 N/A
55 CTR01_CLO E12 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT (control) -15 lacZ pLKO.1 lacZ.1 816 CDS 0.000 N/A
56 CTR01_CLO F01 TRCN0000072238 GTTCCGTCATAGCGATAACGA (control) -15 lacZ pLKO.1 lacZ.1 1932 CDS 3.000 N/A
57 CTR01_CLO F02 TRCN0000072239 GCCGTCGTATTACAACGTCGT (control) -15 lacZ pLKO.1 lacZ.1 25 CDS 2.160 N/A
58 CTR01_CLO F03 TRCN0000072240 TCGTATTACAACGTCGTGACT (control) -15 lacZ pLKO.1 lacZ.1 29 CDS 2.640 N/A
59 CTR01_CLO F04 TRCN0000072241 GCGTTGGCAATTTAACCGCCA (control) -15 lacZ pLKO.1 lacZ.1 2265 CDS 0.540 N/A
60 CTR01_CLO F05 TRCN0000072242 GTCGGCTTACGGCGGTGATTT (control) -15 lacZ pLKO.1 lacZ.1 1758 CDS 4.400 N/A
61 CTR01_CLO F06 TRCN0000072243 CTTCGAAATGTCCGTTCGGTT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 168 CDS 2.640 N/A
62 CTR01_CLO F07 TRCN0000072244 ATCACAGAATCGTCGTATGCA (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 224 CDS 3.000 N/A
63 CTR01_CLO F08 TRCN0000072245 TCACAGAATCGTCGTATGCAG (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 225 CDS 2.640 N/A
64 CTR01_CLO F09 TRCN0000072246 CAAATCACAGAATCGTCGTAT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 221 CDS 4.950 N/A
65 CTR01_CLO F10 TRCN0000072247 GAATCGTCGTATGCAGTGAAA (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 230 CDS 4.950 N/A
66 CTR01_CLO F11 TRCN0000072248 AGTCAAGTAACAACCGCGAAA (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 1510 CDS 4.050 N/A
67 CTR01_CLO F12 TRCN0000072249 GCGGTTGCCAAGAGGTTCCAT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 976 CDS 1.000 N/A
68 CTR01_CLO G01 TRCN0000072250 AGAATCGTCGTATGCAGTGAA (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 229 CDS 4.950 N/A
69 CTR01_CLO G02 TRCN0000072251 GAGTACTTCGAAATGTCCGTT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 163 CDS 2.640 N/A
70 CTR01_CLO G03 TRCN0000072252 ACTTACGCTGAGTACTTCGAA (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 154 CDS 3.000 N/A
71 CTR01_CLO G04 TRCN0000072253 ACACTCGGATATTTGATATGT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 754 CDS 5.625 N/A
72 CTR01_CLO G05 TRCN0000072254 ATGTTTACTACACTCGGATAT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 745 CDS 10.800 N/A
73 CTR01_CLO G06 TRCN0000072255 TCTACTGGTCTGCCTAAAGGT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 601 CDS 3.000 N/A
74 CTR01_CLO G07 TRCN0000072256 ACGCTGAGTACTTCGAAATGT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 158 CDS 5.625 N/A
75 CTR01_CLO G08 TRCN0000072257 TGAGTACTTCGAAATGTCCGT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 162 CDS 0.660 N/A
76 CTR01_CLO G09 TRCN0000072258 TGTCCGGTTATGTAAACAATC (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 1193 CDS 10.800 N/A
77 CTR01_CLO G10 TRCN0000072259 CGCTGAGTACTTCGAAATGTC (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 159 CDS 4.950 N/A
78 CTR01_CLO G11 TRCN0000072260 CAGAATCGTCGTATGCAGTGA (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 228 CDS 2.640 N/A
79 CTR01_CLO G12 TRCN0000072261 CACTCGGATATTTGATATGTG (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 755 CDS 4.950 N/A
80 CTR01_CLO H01 TRCN0000072262 CACTTACGCTGAGTACTTCGA (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 153 CDS 2.640 N/A
81 CTR01_CLO H02 TRCN0000072263 AGTACTTCGAAATGTCCGTTC (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 164 CDS 2.250 N/A
82 CTR01_CLO H03 TRCN0000072264 GCTGAGTACTTCGAAATGTCC (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 160 CDS 2.640 N/A
83 CTR01_CLO H04 TRCN0000072265 GTTGTGTTTGTGGACGAAGTA (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 1546 CDS 4.950 N/A
84 CTR01_CLO H05 TRCN0000072266 GAATGTTTACTACACTCGGAT (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 743 CDS 2.640 N/A
85 CTR01_CLO H06 TRCN0000072267 GCGCCATTCTATCCGCTGGAA (control) -14 LUCIFERASE pLKO.1 promegaLuc.1 34 CDS 0.880 N/A
Download CSV