Gene: Luciferase

Hahn Lab -43
Official symbol:
Wildtype Transcripts:

Hairpins designed to target transcripts from this gene

No results found.

All "non-targeting" hairpins matching current transcripts from this gene

This list includes shRNAs that were designed to match transcripts from a gene other than the queried gene yet have a significant match to the queried gene. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
51 TRCN0000157368 CTCTGTCAAGTACAAAGGCCA human 84954 MPND pLKO.1 462 CDS 86% 90% N/A N/A
52 TRCN0000179486 GCCCTTGTTCCTGAAACAATT human 5557 PRIM1 pLKO.1 797 CDS 90% 89% N/A N/A
53 TRCN0000147609 GAGAAAGAGATCGTGAGATTA human 26118 WSB1 pLKO.1 344 CDS 90% 89% N/A N/A
54 TRCN0000275244 GCCCTTGTTCCTGAAACAATT human 5557 PRIM1 pLKO_TRC005 797 CDS 90% 89% N/A N/A
55 TRCN0000045367 GCTTGGCAGAAGCTATGCAAA human 56474 CTPS2 pLKO.1 1323 CDS 85% 89% N/A N/A
56 TRCN0000162944 GAGACTACAGCAGCTCTTCAA human 54543 TOMM7 pLKO.1 53 CDS 80% 89% N/A N/A
57 TRCN0000424492 CGAAAGGTCTTGACCTGAATG human 93611 FBXO44 pLKO_TRC005 1084 3UTR 80% 89% N/A N/A
58 TRCN0000220031 CTGATTGCAAATAGGCATTTA human 54845 ESRP1 pLKO.1 2482 3UTR 86% 85% N/A N/A
59 TRCN0000006167 CGTCATCAGTATTCTGATTAT human 9414 TJP2 pLKO.1 1458 CDS 81% 85% N/A N/A
60 TRCN0000020753 GCTTTGATTCCAAGGATGGTT human 50805 IRX4 pLKO.1 421 CDS 81% 85% N/A N/A
61 TRCN0000074810 CTGGAGACATTTCTACTGGTA human 6204 RPS10 pLKO.1 233 CDS 81% 85% N/A N/A
62 TRCN0000157516 GACGAAAGTGTCGCAGTCTTT human 9398 CD101 pLKO.1 1860 CDS 81% 85% N/A N/A
63 TRCN0000161513 GCTGAAACCAATCCCAGAATA human 10758 TRAF3IP2 pLKO.1 260 CDS 81% 85% N/A N/A
64 TRCN0000188076 CCCTCTGATTGGTATCCATTT human 11037 STON1 pLKO.1 2000 CDS 81% 85% N/A N/A
65 TRCN0000298184 CTGGAGACATTTCTACTGGTA human 6204 RPS10 pLKO_TRC005 257 CDS 81% 85% N/A N/A
66 TRCN0000359105 TCTGGATTGACAAGATCAAAT human 22985 ACIN1 pLKO_TRC005 3456 CDS 81% 85% N/A N/A
67 TRCN0000315435 CGTCATCAGTATTCTGATTAT human 9414 TJP2 pLKO_TRC005 1458 CDS 81% 85% N/A N/A
68 TRCN0000001991 GAAGACTGGAAGCTGGAGATT human 4294 MAP3K10 pLKO.1 1420 CDS 78% 85% N/A N/A
69 TRCN0000028111 GCTGCTGTCAACCCTTTCTTT human 317749 DHRS4L2 pLKO.1 387 CDS 77% 85% N/A N/A
70 TRCN0000152541 GCCAAGATGTTCATTTGCCTA human 150350 ENTHD1 pLKO.1 880 CDS 77% 85% N/A N/A
71 TRCN0000164836 CAAGATCTTGAAGCAGGTGCA human 126536 LOC126536 pLKO.1 1456 CDS 77% 85% N/A N/A
72 TRCN0000336610 TGGGCTCAGGAGACGACATTT human 57460 PPM1H pLKO_TRC005 1630 CDS 77% 85% N/A N/A
73 TRCN0000424224 CTGAGCACCCTTCAGATTAAG human 223082 ZNRF2 pLKO_TRC005 1761 CDS 77% 85% N/A N/A
74 TRCN0000010098 GCCGTGGTTCTTTGGAGCAAT human 2444 FRK pLKO.1 789 CDS 77% 85% N/A N/A
75 TRCN0000438473 ACGCAGGTGCATGGTCTTCAA human 2516 NR5A1 pLKO_TRC005 1027 CDS 75% 81% N/A N/A
76 TRCN0000117723 CCAGAAGATCATGTTTGGCAA human 23481 PES1 pLKO.1 1718 CDS 82% 80% N/A N/A
77 TRCN0000145207 GAACATGAAGCTCAACACTAT human 55279 ZNF654 pLKO.1 932 CDS 82% 80% N/A N/A
78 TRCN0000359762 TGGCAGAGCTATAAGCGTTAT human 57134 MAN1C1 pLKO_TRC005 886 CDS 82% 80% N/A N/A
79 TRCN0000300707 CCAGAAGATCATGTTTGGCAA human 23481 PES1 pLKO_TRC005 1718 CDS 82% 80% N/A N/A
80 TRCN0000420606 TGGAGCTCTGGACTCCTAAAT human 219541 MED19 pLKO_TRC005 616 3UTR 78% 80% N/A N/A
81 TRCN0000006766 CAAGTACAACGCCAACAAGAC human 1504 CTRB1 pLKO.1 502 CDS 73% 80% N/A N/A
82 TRCN0000019783 GCTGGGCATAATGAAGAGGAT human 8204 NRIP1 pLKO.1 411 CDS 73% 80% N/A N/A
83 TRCN0000358936 GTTCCAACACCCACATCATTC human 653166 OR1D4 pLKO_TRC005 620 CDS 73% 80% N/A N/A
84 TRCN0000257355 GTGAGATCCTAGTGATAATAG human 1399 CRKL pLKO_TRC005 949 CDS 73% 80% N/A N/A
85 TRCN0000428433 TCCGAGAGGTCATGATTATAG human 84186 ZCCHC7 pLKO_TRC005 619 CDS 73% 80% N/A N/A
86 TRCN0000434171 GACCTTCAGGATCAAGATTAT human 10180 RBM6 pLKO_TRC005 1563 CDS 73% 80% N/A N/A
87 TRCN0000168883 CTGGGAAAGAAACACTTCCTT human 152404 IGSF11 pLKO.1 1544 3UTR 76% 78% N/A N/A
88 TRCN0000015414 CAAGAAGGACAAGTTCGCCTT human 11166 SOX21 pLKO.1 347 CDS 75% 77% N/A N/A
89 TRCN0000364749 TCTGAGAGACCCTGGATTAAA human 57136 C20orf3 pLKO_TRC005 1107 CDS 75% 77% N/A N/A
90 TRCN0000376409 TGCGGATATGGACGGGAAATC human 55959 SULF2 pLKO_TRC005 1464 CDS 75% 77% N/A N/A
91 TRCN0000380069 TAAAGGAGAAGTGGCTGAATG human 26469 PTPN18 pLKO_TRC005 586 CDS 75% 77% N/A N/A
92 TRCN0000000409 GATCCTCAAGAAGAAGAAGTT human 6794 STK11 pLKO.1 505 CDS 70% 77% N/A N/A
93 TRCN0000001670 GCCAACATTTCCCTTCTTCCA human 5468 PPARG pLKO.1 1626 3UTR 70% 77% N/A N/A
94 TRCN0000003768 TGGAAGAAACGCCTGGAGAAT human 1728 NQO1 pLKO.1 672 CDS 70% 77% N/A N/A
95 TRCN0000073244 CCTGCGAGAATCTCCATGATT human 285498 RNF212 pLKO.1 627 CDS 70% 77% N/A N/A
96 TRCN0000148276 CTTCACTTACGAGTACATCAT human 360023 ZBTB41 pLKO.1 1822 CDS 70% 77% N/A N/A
97 TRCN0000152594 GATAGGCAAGAAGTTGCAGAA human 4146 MATN1 pLKO.1 1815 CDS 70% 77% N/A N/A
98 TRCN0000183686 GCTGGAAGACTGAATAATGAA human 11061 LECT1 pLKO.1 712 CDS 70% 77% N/A N/A
99 TRCN0000137982 GAATACTGTGTGCCTAGAGGA human 55859 BEX1 pLKO.1 295 CDS 70% 77% N/A N/A
100 TRCN0000350361 TGGAAGAAACGCCTGGAGAAT human 1728 NQO1 pLKO_TRC005 813 CDS 70% 77% N/A N/A
101 TRCN0000018967 CCTGCATATATGAAGAGAAAT human 117608 ZNF354B pLKO.1 550 CDS 72% 73% N/A N/A
102 TRCN0000367736 TGGTGAACATCACGCTGAGTG human 8698 S1PR4 pLKO_TRC005 279 CDS 72% 73% N/A N/A
103 TRCN0000025171 CGCTCCAACTCTCTAAGGAAA mouse 241656 Pak7 pLKO.1 859 CDS 85% 89% N/A N/A
104 TRCN0000123776 CCAGTCAATGTAACAACTGAA mouse 13627 Eef1a1 pLKO.1 940 CDS 80% 89% N/A N/A
105 TRCN0000126902 AGCACTCTGATCTACAAATTT mouse 77975 Tmem50b pLKO.1 573 CDS 80% 89% N/A N/A
106 TRCN0000309579 CCAGTCAATGTAACAACTGAA mouse 13627 Eef1a1 pLKO_TRC005 964 CDS 80% 89% N/A N/A
107 TRCN0000326596 AGCACTCTGATCTACAAATTT mouse 77975 Tmem50b pLKO_TRC005 570 CDS 80% 89% N/A N/A
108 TRCN0000365854 TTGCAGAAGCGTATGAAACAC mouse 27362 Dnajb9 pLKO_TRC005 348 CDS 80% 89% N/A N/A
109 TRCN0000120915 ACCAGACAATTGACTCATCAT mouse 11610 Agtrap pLKO.1 505 CDS 86% 85% N/A N/A
110 TRCN0000012853 GCACACTTAGACACATCAGCA mouse 12236 Bub1b pLKO.1 3402 3UTR 81% 85% N/A N/A
111 TRCN0000086794 GCCTACATGCAGCATTCTGTT mouse 319875 Tmprss11bnl pLKO.1 814 CDS 81% 85% N/A N/A
112 TRCN0000108797 ACAACTACAAAGGCTATGAAA mouse 74103 Nebl pLKO.1 333 CDS 81% 85% N/A N/A
113 TRCN0000336321 AGCACGCGTGATGACAAATAA mouse 268859 Rbfox1 pLKO_TRC005 1902 CDS 81% 85% N/A N/A
114 TRCN0000414725 ATGGATGGCTCAGTCTGAATA mouse 15002 H2-Ob pLKO_TRC005 706 CDS 81% 85% N/A N/A
115 TRCN0000448801 GCAAGGATTGATGGCACATTT mouse 231214 Cc2d2a pLKO_TRC005 3982 CDS 81% 85% N/A N/A
116 TRCN0000031312 CGTCACATTCTCTACCACCAA mouse 17287 Mep1a pLKO.1 2260 CDS 78% 85% N/A N/A
117 TRCN0000041948 GCCATTCATCTGTGGAAGAAA mouse 20148 Dhrs3 pLKO.1 2107 3UTR 78% 85% N/A N/A
118 TRCN0000054770 CAACTCTTAGAGCAGGTGTTT mouse 23955 Nek4 pLKO.1 2368 CDS 78% 85% N/A N/A
119 TRCN0000067471 CTTCTTCACGTTGAGCGTCAA mouse 12702 Socs3 pLKO.1 610 CDS 77% 85% N/A N/A
120 TRCN0000096358 GAATACGTTGAGTGCCAGAAA mouse 231866 Zfp12 pLKO.1 759 CDS 77% 85% N/A N/A
121 TRCN0000114774 TGTGGACAAGTACGGAATGAA mouse 16011 Igfbp5 pLKO.1 1470 CDS 77% 85% N/A N/A
122 TRCN0000184943 CAATCAAGAGATTCCTCATTT mouse 258508 Olfr99 pLKO.1 501 CDS 77% 85% N/A N/A
123 TRCN0000239594 ATGCTCAGAGACCTATGTTAA mouse 74901 Kbtbd11 pLKO_TRC005 7615 3UTR 77% 85% N/A N/A
124 TRCN0000270461 CAGATCAAGAATCTTCGTAAA mouse 545693 Gm13043 pLKO_TRC005 711 CDS 77% 85% N/A N/A
125 TRCN0000421942 CAAGGATTTAGTCGAAGTATG mouse 252910 Vmn1r71 pLKO_TRC005 1041 CDS 77% 85% N/A N/A
126 TRCN0000076527 GTGTGACAGCATATGATTATT mouse 20463 Cox7a2l pLKO.1 166 CDS 78% 80% N/A N/A
127 TRCN0000191263 CGGTTTACCTATTACACGATA mouse 76577 Faf2 pLKO.1 329 CDS 78% 80% N/A N/A
128 TRCN0000189750 GCTCAGTGAGATTATCAGCGA mouse 75645 1700011F14Rik pLKO.1 328 CDS 78% 80% N/A N/A
129 TRCN0000190479 GCACTGTGTTTAGAGTCCTTT mouse 245631 Mum1l1 pLKO.1 2685 3UTR 78% 80% N/A N/A
130 TRCN0000328270 AGCTGAATGAATCCATATTTC mouse 209012 Ulk4 pLKO_TRC005 1217 CDS 78% 80% N/A N/A
131 TRCN0000312335 GTGTGACAGCATATGATTATT mouse 20463 Cox7a2l pLKO_TRC005 198 CDS 78% 80% N/A N/A
132 TRCN0000009909 TGCCTAATAAGCTCCTGCGTA mouse 14394 Gabra1 pLKO.1 1200 CDS 78% 80% N/A N/A
133 TRCN0000032832 CTCTTTCAATCTCTATGACAT mouse 17224 Mcpt1 pLKO.1 344 CDS 73% 80% N/A N/A
134 TRCN0000087407 GACAACGGATTAAGGGATTAA mouse 245589 LOC245589 pLKO.1 404 CDS 73% 80% N/A N/A
135 TRCN0000103559 CGTAAGGATGAAGAGATAAAT mouse 26885 Casp8ap2 pLKO.1 637 CDS 73% 80% N/A N/A
136 TRCN0000178121 GCTGACATACATCACAGAGAA mouse 228356 1110051M20Rik pLKO.1 1222 3UTR 73% 80% N/A N/A
137 TRCN0000195949 CGTCGCTGTCAATAGCAACTT mouse 68845 Pih1d1 pLKO.1 511 CDS 73% 80% N/A N/A
138 TRCN0000198072 CTCCAACACTCTCATCTTCAT mouse 237891 Gas2l2 pLKO.1 738 CDS 73% 80% N/A N/A
139 TRCN0000258150 GAGCTGTCTGACGATCCTTAT mouse 66446 Exosc7 pLKO_TRC005 576 CDS 73% 80% N/A N/A
140 TRCN0000317888 CGTAAGGATGAAGAGATAAAT mouse 26885 Casp8ap2 pLKO_TRC005 677 CDS 73% 80% N/A N/A
141 TRCN0000340831 CGTCGCTGTCAATAGCAACTT mouse 68845 Pih1d1 pLKO_TRC005 510 CDS 73% 80% N/A N/A
142 TRCN0000271967 TCTAAAGCCTCTGATACAAAT mouse 670472 Gm11569 pLKO_TRC005 687 3UTR 79% 77% N/A N/A
143 TRCN0000088918 GCCAGGTTTCAGCGATGTTAA mouse 12662 Chm pLKO.1 3362 3UTR 75% 77% N/A N/A
144 TRCN0000251036 TGTCAGGCAGAATGGGCTTAT mouse 67976 Trabd pLKO_TRC005 521 CDS 75% 77% N/A N/A
145 TRCN0000303210 GCCAGGTTTCAGCGATGTTAA mouse 12662 Chm pLKO_TRC005 3357 3UTR 75% 77% N/A N/A
146 TRCN0000216307 GAGAATCATCTATGGTGAATG mouse 68166 Spire1 pLKO.1 670 CDS 70% 77% N/A N/A
147 TRCN0000249676 TGAATGGTACATTGGAGAATA mouse 27278 Clnk pLKO_TRC005 1055 CDS 70% 77% N/A N/A
148 TRCN0000201511 CCAACTCTTCAAAGGTGTGAA mouse 54632 Ftsj1 pLKO.1 380 CDS 68% 73% N/A N/A
149 TRCN0000190119 CCGGAAAGAACGGAAGAAAGA mouse 69202 Ptms pLKO.1 414 CDS 73% 70% N/A N/A
150 TRCN0000346743 CCGGAAAGAACGGAAGAAAGA mouse 69202 Ptms pLKO_TRC005 414 CDS 73% 70% N/A N/A
Download CSV

All hairpins matching current transcripts from this gene

(this is the union of the above two tables, provided here as a single download link)

Download CSV

ORFs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464768 CONTROL Luciferase.1 -43 Luciferase pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
2 ccsbBroad301_99992 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
3 ccsbBroad301_99993 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
4 ccsbBroad301_99991 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
5 ccsbBroad301_99982 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
6 ccsbBroad304_99991 CONTROL Luciferase.1 -43 Luciferase pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
7 ccsbBroad304_99992 CONTROL Luciferase.1 -43 Luciferase pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
8 BRDN0000559440 CONTROL Luciferase.1 -43 Luciferase pLX_TRC307 0% 99.8% 99.8% V5 1651_1653delTTG
9 BRDN0000464779 CONTROL Luciferase.1 -43 Luciferase pLX_TRC302 0% 99.8% 99.8% V5 1651_1653delTTG
10 BRDN0000556282 CONTROL Luciferase.1 -43 Luciferase pLX_TRC303 0% 99.8% 99.8% None 1651_1653delTTG
11 BRDN0000556262 CONTROL Luciferase.1 -43 Luciferase pLX_TRC305 0% 99.8% 99.8% None 1651_1653delTTG
12 BRDN0000556299 CONTROL Luciferase.1 -43 Luciferase pLX_TRC306 0% 99.8% 99.8% V5 1651_1653delTTG
13 BRDN0000556280 CONTROL Luciferase.1 -43 Luciferase pLXI_TRC401 0% 99.8% 99.8% None 1651_1653delTTG
14 BRDN0000556275 CONTROL Luciferase.1 -43 Luciferase pLXI_TRC402 0% 99.8% 99.8% HA 1651_1653delTTG
15 BRDN0000556301 CONTROL Luciferase.1 -43 Luciferase pLX_TRC311 0% 99.8% 99.8% V5 1651_1653delTTG
16 BRDN0000556296 CONTROL Luciferase.1 -43 Luciferase pLX_TRC312 0% 99.8% 99.8% V5 1651_1653delTTG
17 BRDN0000556302 CONTROL Luciferase.1 -43 Luciferase pLX_TRC313 0% 99.8% 99.8% V5 1651_1653delTTG
18 BRDN0000556293 CONTROL Luciferase.1 -43 Luciferase pLX_TRC314 0% 99.8% 99.8% V5 1651_1653delTTG
19 BRDN0000556270 CONTROL Luciferase.1 -43 Luciferase pLX_TRC315 0% 99.8% 99.8% V5 1651_1653delTTG
20 BRDN0000556289 CONTROL Luciferase.1 -43 Luciferase pLXI_TRC403 0% 99.8% 99.8% V5 1651_1653delTTG
21 ccsbBroad304_99993 CONTROL Luciferase.1 -43 Luciferase pLX_TRC304 44.2% 76.6% 56.4% V5 (not translated due to prior stop codon) (many diffs)
22 BRDN0000464769 CONTROL Luciferase.1 -43 Luciferase pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
23 BRDN0000464770 CONTROL Luciferase.1 -43 Luciferase pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
Download CSV