Gene: hlucPlus

Identifier:
JKG -18
Official symbol:
hlucPlus
Description:
gi 42718122 bases 2532-4184 firefly luciferase ORF in psiCHECK2
Taxon:
CONTROL
Chromosome:
n/a
Wildtype Transcripts:
hlucPlus.1

Hairpins designed to target transcripts from this gene

No results found.

All "non-targeting" hairpins matching current transcripts from this gene

This list includes shRNAs that were designed to match transcripts from a gene other than the queried gene yet have a significant match to the queried gene. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000072251 GAGTACTTCGAAATGTCCGTT CONTROL -14 LUCIFERASE pLKO.1 163 CDS 85% 89% N/A N/A
2 TRCN0000072263 AGTACTTCGAAATGTCCGTTC CONTROL -14 LUCIFERASE pLKO.1 164 CDS 85% 89% N/A N/A
3 TRCN0000072264 GCTGAGTACTTCGAAATGTCC CONTROL -14 LUCIFERASE pLKO.1 160 CDS 85% 89% N/A N/A
4 TRCN0000231728 GAGTACTTCGAAATGTCCGTT CONTROL -14 LUCIFERASE pLKO_TRC005 163 CDS 85% 89% N/A N/A
5 TRCN0000231739 AGTACTTCGAAATGTCCGTTC CONTROL -14 LUCIFERASE pLKO_TRC005 164 CDS 85% 89% N/A N/A
6 TRCN0000231741 GCTGAGTACTTCGAAATGTCC CONTROL -14 LUCIFERASE pLKO_TRC005 160 CDS 85% 89% N/A N/A
7 TRCN0000157368 CTCTGTCAAGTACAAAGGCCA human 84954 MPND pLKO.1 462 CDS 86% 90% N/A N/A
8 TRCN0000425084 GGACGAGCAACTTCATCATTG human 6517 SLC2A4 pLKO_TRC005 1483 CDS 85% 89% N/A N/A
9 TRCN0000053759 CGTGTTCGACAAGGACGGCAA human 810 CALML3 pLKO.1 398 CDS 80% 89% N/A N/A
10 TRCN0000061948 GAGAACATTAAGAAGGGCAAA human 1490 CTGF pLKO.1 887 CDS 80% 89% N/A N/A
11 TRCN0000149687 GAACACTGCTAGACCATGAAT human 134829 CLVS2 pLKO.1 457 CDS 80% 89% N/A N/A
12 TRCN0000181086 CAGCACCCGTAACATCTTCAT human 11033 ADAP1 pLKO.1 789 CDS 80% 89% N/A N/A
13 TRCN0000218350 GAAGGAGTTTGTGGACTATTA human 5253 PHF2 pLKO_TRC005 669 CDS 80% 89% N/A N/A
14 TRCN0000147187 CCTGAAGTTCTGGATCAAATA human 57554 LRRC7 pLKO.1 628 CDS 86% 85% N/A N/A
15 TRCN0000236401 GAGAAGGAGAGTCGGGATTAT human 10147 SUGP2 pLKO_TRC005 687 CDS 86% 85% N/A N/A
16 TRCN0000245974 ACTCGGACGGGACGCGCACTT human 342898 SYCN pLKO_TRC005 104 CDS 86% 85% N/A N/A
17 TRCN0000057342 AGACCAGACCAGCAGGAGATA human 3106 HLA-B pLKO.1 767 CDS 82% 85% N/A N/A
18 TRCN0000129474 GCAGTTTACATCCAGTGCTGT human 55599 RNPC3 pLKO.1 987 CDS 82% 85% N/A N/A
19 TRCN0000022218 CCCACTGTAAAGGAGGAGGGT human 7376 NR1H2 pLKO.1 326 CDS 81% 85% N/A N/A
20 TRCN0000074810 CTGGAGACATTTCTACTGGTA human 6204 RPS10 pLKO.1 233 CDS 81% 85% N/A N/A
21 TRCN0000143000 CGAGGAGAACACTTCTTCTTA human 127670 TEDDM1 pLKO.1 1369 3UTR 81% 85% N/A N/A
22 TRCN0000152551 GAGATGGAAGATGTGGACTTT human 14 AAMP pLKO.1 190 CDS 81% 85% N/A N/A
23 TRCN0000240321 GGCCTATGCAAGAACAATAAA human 4710 NDUFB4 pLKO_TRC005 277 CDS 81% 85% N/A N/A
24 TRCN0000263705 TCACCGTAGGCCAGTACTTTG human 84915 C12orf34 pLKO_TRC005 1182 CDS 81% 85% N/A N/A
25 TRCN0000298184 CTGGAGACATTTCTACTGGTA human 6204 RPS10 pLKO_TRC005 257 CDS 81% 85% N/A N/A
26 TRCN0000371001 GCAAACCATGAATCGAGAATG human 23076 RRP1B pLKO_TRC005 411 CDS 81% 85% N/A N/A
27 TRCN0000412713 TTGCTGGACACACGCAAGAAC human 7625 ZNF74 pLKO_TRC005 1028 CDS 81% 85% N/A N/A
28 TRCN0000429108 CAACAAGACGACTGCGTGCTA human 388531 RGS9BP pLKO_TRC005 896 CDS 81% 85% N/A N/A
29 TRCN0000429708 TGAGACTCTCTCAGTTGTTTC human 80789 INTS5 pLKO_TRC005 2192 CDS 78% 85% N/A N/A
30 TRCN0000019290 GCCTGAGAAGATCCTCAAGAA human 4298 MLLT1 pLKO.1 1607 CDS 77% 85% N/A N/A
31 TRCN0000028450 GCCTATGCAAGAACAATAAAT human 4710 NDUFB4 pLKO.1 284 CDS 77% 85% N/A N/A
32 TRCN0000036876 CCAGAGCATGGACAATTCCAA human 2874 GPS2 pLKO.1 3159 CDS 77% 85% N/A N/A
33 TRCN0000052677 CCAGGGCTAGCCCTGACCAGT human 93650 ACPT pLKO.1 148 CDS 77% 85% N/A N/A
34 TRCN0000059381 GCAGTACTTCAGCCAGTTCAA human 114757 CYGB pLKO.1 329 CDS 77% 85% N/A N/A
35 TRCN0000199049 CCAGCTGAGCTGAAGCTATTT human 5255 PHKA1 pLKO.1 1104 CDS 77% 85% N/A N/A
36 TRCN0000161384 GCTTCCAGAGATGGAAACAAA human 5929 RBBP5 pLKO.1 2505 3UTR 77% 85% N/A N/A
37 TRCN0000163147 GAGAAGGAATCGTGGATCAAT human 51177 PLEKHO1 pLKO.1 639 CDS 77% 85% N/A N/A
38 TRCN0000268592 TCCGCAAATCTCGCGAGATAG human 54627 KIAA1383 pLKO_TRC005 441 CDS 77% 85% N/A N/A
39 TRCN0000342702 CCAGCTGAGCTGAAGCTATTT human 5255 PHKA1 pLKO_TRC005 1244 CDS 77% 85% N/A N/A
40 TRCN0000425667 ATCATGCAGCTCGGCTCTATC human 64446 DNAI2 pLKO_TRC005 438 CDS 79% 81% N/A N/A
41 TRCN0000036809 CTGGAGTATCTTCAAGTACAA human 2787 GNG5 pLKO.1 482 CDS 82% 80% N/A N/A
42 TRCN0000045583 CCTGTTCTAATTGCACGGATT human 6301 SARS pLKO.1 1256 CDS 82% 80% N/A N/A
43 TRCN0000072989 GACCGTGAAGTTTCTGACCAA human 51285 RASL12 pLKO.1 323 CDS 82% 80% N/A N/A
44 TRCN0000116917 GCTTCTTAACAGATGGCATTT human 123920 CMTM3 pLKO.1 1831 3UTR 82% 80% N/A N/A
45 TRCN0000299211 GCTTCTTAACAGATGGCATTT human 123920 CMTM3 pLKO_TRC005 1831 3UTR 82% 80% N/A N/A
46 TRCN0000286870 CTGGAGTATCTTCAAGTACAA human 2787 GNG5 pLKO_TRC005 503 CDS 82% 80% N/A N/A
47 TRCN0000017662 GCCTTCAACCAGAAATCAATA human 92285 ZNF585B pLKO.1 1926 CDS 78% 80% N/A N/A
48 TRCN0000036076 TCCACTCTGGACATTGGCTAA human 2523 FUT1 pLKO.1 1174 CDS 78% 80% N/A N/A
49 TRCN0000130245 CCGATGAAGAACAGCAAGAAA human 55153 SDAD1 pLKO.1 1412 CDS 78% 80% N/A N/A
50 TRCN0000155024 GAGAGGCAGAGTGGACTATTT human 51129 ANGPTL4 pLKO.1 781 CDS 78% 80% N/A N/A
51 TRCN0000160130 CAAGTACACTCGTGATATCTA human 746 C11orf10 pLKO.1 187 CDS 78% 80% N/A N/A
52 TRCN0000281084 CCGATGAAGAACAGCAAGAAA human 55153 SDAD1 pLKO_TRC005 1675 CDS 78% 80% N/A N/A
53 TRCN0000417601 GGCCCTTCCCTGCTATCCTTT human 23082 PPRC1 pLKO_TRC005 5040 3UTR 78% 80% N/A N/A
54 TRCN0000022441 CTGCCCATCTACTGCCTGTCA human 80019 UBTD1 pLKO.1 536 CDS 73% 80% N/A N/A
55 TRCN0000039884 CCAGCCTCAAACTACAATAAA human 2033 EP300 pLKO.1 4859 CDS 73% 80% N/A N/A
56 TRCN0000044372 GATGGGCTTCTCAGTCCTAAT human 27094 KCNMB3 pLKO.1 707 CDS 73% 80% N/A N/A
57 TRCN0000047624 CCAGAACTGCTCGCGGAGTAA human 57799 RAB40C pLKO.1 931 CDS 73% 80% N/A N/A
58 TRCN0000057293 GCCAGGGACACCGCACAGATT human 3133 HLA-E pLKO.1 262 CDS 73% 80% N/A N/A
59 TRCN0000060378 GCTGGATCTTACTGGTGCAAA human 342510 CD300E pLKO.1 336 CDS 73% 80% N/A N/A
60 TRCN0000064235 CCCATTGTTCTAAAGGTGGAT human 1577 CYP3A5 pLKO.1 1546 CDS 73% 80% N/A N/A
61 TRCN0000078151 CCCTGGCTACATATTTGGGAA human 241 ALOX5AP pLKO.1 401 CDS 73% 80% N/A N/A
62 TRCN0000127818 GCCAAGGTTTGACATGGACTT human 80059 LRRTM4 pLKO.1 1149 CDS 73% 80% N/A N/A
63 TRCN0000141947 GCCAGATTCTTGACAAGGATT human 84923 FAM104A pLKO.1 2154 3UTR 73% 80% N/A N/A
64 TRCN0000148488 CAGATCATCATCAGTGCTGAA human 338567 KCNK18 pLKO.1 601 CDS 73% 80% N/A N/A
65 TRCN0000166578 CCTGACAGACAACCATCTCTT human 83888 FGFBP2 pLKO.1 781 3UTR 73% 80% N/A N/A
66 TRCN0000239626 GTGCAGCAAGATGGCCTATAC human 154790 CLEC2L pLKO_TRC005 621 CDS 73% 80% N/A N/A
67 TRCN0000256253 CACATTGTGAATCCCATATTT human 27252 KLHL20 pLKO_TRC005 1984 CDS 73% 80% N/A N/A
68 TRCN0000378984 GGAGAACACCATTCCTGATTT human 11341 SCRG1 pLKO_TRC005 728 3UTR 73% 80% N/A N/A
69 TRCN0000262307 GAAGATCAGATCAACTCTAAA human 729920 ISPD pLKO_TRC005 415 CDS 76% 78% N/A N/A
70 TRCN0000272392 ATTGCCTCCGAGCCCACTTTA human 642502 LOC642502 pLKO_TRC005 35 CDS 76% 78% N/A N/A
71 TRCN0000180471 GCTGGTCAACCTCTTCATCTT human 1101 CHAD pLKO.1 584 CDS 79% 77% N/A N/A
72 TRCN0000274340 CAAGGACAAGAGGCGCAAGAT human 10481 HOXB13 pLKO_TRC005 882 CDS 79% 77% N/A N/A
73 TRCN0000372558 TGATGACAAGGAACCTGTATA human 29949 IL19 pLKO_TRC005 1471 CDS 79% 77% N/A N/A
74 TRCN0000000409 GATCCTCAAGAAGAAGAAGTT human 6794 STK11 pLKO.1 505 CDS 75% 77% N/A N/A
75 TRCN0000006449 GCTTCCTGATACAAGACGACT human 3002 GZMB pLKO.1 218 CDS 75% 77% N/A N/A
76 TRCN0000145618 CCACTTGAAGTACATCATCAA human 389690 FLJ43860 pLKO.1 390 CDS 75% 77% N/A N/A
77 TRCN0000141106 CTACAAAGGCTTGAGCATGAA human 284439 SLC25A42 pLKO.1 1005 CDS 75% 77% N/A N/A
78 TRCN0000138496 CAGAAGCTGAAGGTGTCAGAT human 55668 C14orf118 pLKO.1 519 CDS 75% 77% N/A N/A
79 TRCN0000155831 CTTCATCTTCCGCAAGAGCAA human 56666 PANX2 pLKO.1 906 CDS 75% 77% N/A N/A
80 TRCN0000239505 CCATTGCCCTCTTGAACATTT human 441722 LOC441722 pLKO_TRC005 624 CDS 75% 77% N/A N/A
81 TRCN0000241714 AGCTGGTGAACATGGGCTTTC human 219738 C10orf35 pLKO_TRC005 379 CDS 75% 77% N/A N/A
82 TRCN0000428653 TACTGTGGGTTTGTCTAATAC human 252983 STXBP4 pLKO_TRC005 759 CDS 75% 77% N/A N/A
83 TRCN0000447726 TCAGCACCCTCTACCTGAATC human 387733 IFITM5 pLKO_TRC005 161 CDS 75% 77% N/A N/A
84 TRCN0000127527 CAAGGTGAACCTGAACACCAT human 56342 PPAN pLKO.1 616 CDS 70% 77% N/A N/A
85 TRCN0000166606 CGTGGAGTTCCTGAAGAAGAA human 55643 BTBD2 pLKO.1 627 CDS 70% 77% N/A N/A
86 TRCN0000428058 CCTCAAGGCCGAAGGGTATTG human 93611 FBXO44 pLKO_TRC005 546 CDS 70% 77% N/A N/A
87 TRCN0000419499 GAGAACCTGCAGTCCTTTAAC human 489 ATP2A3 pLKO_TRC005 2216 CDS 70% 77% N/A N/A
88 TRCN0000033889 GCCAGACTATCGAGGACAATA human 57159 TRIM54 pLKO.1 722 CDS 73% 75% N/A N/A
89 TRCN0000372358 TGAAGAAGCCTATATCCTGAA human 2689 GH2 pLKO_TRC005 233 CDS 76% 73% N/A N/A
90 TRCN0000146646 CCATGAAGAAGAAATCGTTCA human 93974 ATPIF1 pLKO.1 303 CDS 72% 73% N/A N/A
91 TRCN0000150110 CACCATGAAGAAGAAATCGTT human 93974 ATPIF1 pLKO.1 301 CDS 72% 73% N/A N/A
92 TRCN0000157544 GACTACATCATTCTGCCCACA human 8933 FAM127A pLKO.1 737 CDS 68% 73% N/A N/A
93 TRCN0000195516 CTCCTGAAGTGATCAACTATG human 4638 MYLK pLKO.1 4961 CDS 68% 73% N/A N/A
94 TRCN0000322937 GACTACATCATTCTGCCCACA human 8933 FAM127A pLKO_TRC005 801 3UTR 68% 73% N/A N/A
95 TRCN0000027788 GACAGGTACAAAGCCATTGTA mouse 14829 Grpr pLKO.1 762 CDS 80% 89% N/A N/A
96 TRCN0000119419 CGGGAGATTCTGATCAAGGAA mouse 26562 Ncdn pLKO.1 1789 CDS 80% 89% N/A N/A
97 TRCN0000189983 GAGCTCTCTGAGTTCCTTCAT mouse 319998 Tmem198 pLKO.1 1634 CDS 86% 85% N/A N/A
98 TRCN0000249093 TGCTGACAAGTGCCATGAAGA mouse 73719 Lce1c pLKO_TRC005 512 CDS 86% 85% N/A N/A
99 TRCN0000024673 CGCCAACCTGGTGTTCGTGTA mouse 12570 Cdk5r2 pLKO.1 699 CDS 81% 85% N/A N/A
100 TRCN0000328418 TGAAGTCTGGATCCAAGTAAA mouse 17763 Mtcp1 pLKO_TRC005 727 CDS 81% 85% N/A N/A
101 TRCN0000067599 CGAGGAAAGTTGTTCCTGCAA mouse 12475 Cd14 pLKO.1 241 CDS 77% 85% N/A N/A
102 TRCN0000067750 CTATGTGCAAACCCTGAGGAA mouse 65956 Ccl21c pLKO.1 256 CDS 77% 85% N/A N/A
103 TRCN0000099024 GCCCACTGCTTAGGAGGTGTT mouse 235612 Fbxw19 pLKO.1 1246 CDS 77% 85% N/A N/A
104 TRCN0000103492 CAATGCCATCACCGTGCCCTT mouse 19291 Purb pLKO.1 835 CDS 77% 85% N/A N/A
105 TRCN0000124238 AGACCATGAACGCGAGGAGCA mouse 19119 Prm2 pLKO.1 156 CDS 77% 85% N/A N/A
106 TRCN0000217729 GCACCATTCCTTCACCAAATT mouse 72949 Ccnt2 pLKO.1 274 CDS 77% 85% N/A N/A
107 TRCN0000218469 ACAGCCTGCAATCTACAAATA mouse 240442 Adnp2 pLKO_TRC005 3880 3UTR 77% 85% N/A N/A
108 TRCN0000374126 CTGCAGAACAGATGGTCATAG mouse 13555 E2f1 pLKO_TRC005 873 CDS 77% 85% N/A N/A
109 TRCN0000069777 CGGCTGGTTCACTCTGGAGTA mouse 382571 Kcnf1 pLKO.1 1033 CDS 77% 85% N/A N/A
110 TRCN0000216799 GAGAACTCTGCAGATCTTGAT mouse 59032 Ppp2r3c pLKO.1 1563 CDS 82% 80% N/A N/A
111 TRCN0000196155 GCTCATTTGCTCCTGCTTCTA mouse 20262 Stmn3 pLKO.1 346 CDS 78% 80% N/A N/A
112 TRCN0000232390 CTGGATGCAGTGGCGACATTT mouse 56717 Mtor pLKO_TRC005 8173 3UTR 78% 80% N/A N/A
113 TRCN0000321383 GCGCGACTGTGATCATCATAG mouse 13591 Ebf1 pLKO_TRC005 875 CDS 78% 80% N/A N/A
114 TRCN0000067153 CCTGAGAAACAACCAGCTCAT mouse 16181 Il1rn pLKO.1 217 CDS 73% 80% N/A N/A
115 TRCN0000198703 CAAGACCAAGGCAGAAGGAAT mouse 74954 4930503E14Rik pLKO.1 124 CDS 73% 80% N/A N/A
116 TRCN0000240287 GTGCAGCAAGATGGCCTATAC mouse 665180 Clec2l pLKO_TRC005 779 CDS 73% 80% N/A N/A
117 TRCN0000325690 CCTGAGAAACAACCAGCTCAT mouse 16181 Il1rn pLKO_TRC005 216 CDS 73% 80% N/A N/A
118 TRCN0000187721 GCTGCTATCATGAAGATCCAT mouse 259144 Olfr456 pLKO.1 664 CDS 72% 78% N/A N/A
119 TRCN0000054657 CATGAGCATGAGAGAGGAGAT mouse 18740 Pitx1 pLKO.1 833 CDS 79% 77% N/A N/A
120 TRCN0000348390 CTGTGGCCCTGAAGGACATTT mouse 116905 Dph1 pLKO_TRC005 1115 CDS 79% 77% N/A N/A
121 TRCN0000121464 CATCATGGATATGACCGTCTT mouse 80752 Fam20c pLKO.1 1850 CDS 75% 77% N/A N/A
122 TRCN0000250771 CATGGACAAGATCCGACAACA mouse 14607 Gip pLKO_TRC005 270 CDS 75% 77% N/A N/A
123 TRCN0000295772 TGCTGTGTGTCGGCCTTATTA mouse 50907 Preb pLKO_TRC005 1443 CDS 75% 77% N/A N/A
124 TRCN0000328779 CATCATGGATATGACCGTCTT mouse 80752 Fam20c pLKO_TRC005 1869 CDS 75% 77% N/A N/A
125 TRCN0000023637 CGAGTATGAGTTGCCAGAGGA mouse 381968 LOC381968 pLKO.1 216 CDS 70% 77% N/A N/A
126 TRCN0000042693 CGGCTACAGTAACCCTAAGAT mouse 16476 Jun pLKO.1 994 CDS 70% 77% N/A N/A
127 TRCN0000068352 CCAGAGTCAGACAGAGACATT mouse 16510 Kcnh1 pLKO.1 3048 CDS 70% 77% N/A N/A
128 TRCN0000070465 CCCGCACCCTACTCGGCAGTT mouse 11859 Phox2a pLKO.1 226 CDS 70% 77% N/A N/A
129 TRCN0000085549 CCAAGAAGGATCTGGACTTAA mouse 21425 Tfeb pLKO.1 1526 CDS 70% 77% N/A N/A
130 TRCN0000119655 CCTGACCTATGCCTACTTCAT mouse 99571 Fgg pLKO.1 912 CDS 70% 77% N/A N/A
131 TRCN0000187344 CCAGTTCTTCATAGTGCTCTT mouse 404337 Olfr1383 pLKO.1 297 CDS 70% 77% N/A N/A
132 TRCN0000249491 TCACCATCCTCTACCTGTTCA mouse 269295 Rtn4rl2 pLKO_TRC005 686 CDS 70% 77% N/A N/A
133 TRCN0000267828 GCCCTGCTGCCTACCATTATA mouse 71903 Ces2f pLKO_TRC005 798 CDS 70% 77% N/A N/A
134 TRCN0000353172 TGGAACAGCAAACCACGAAAT mouse 26404 Map3k12 pLKO_TRC005 1389 CDS 70% 77% N/A N/A
135 TRCN0000431760 AGAGCTACAGCCACACCAAAG mouse 18094 Nkx2-9 pLKO_TRC005 997 3UTR 70% 77% N/A N/A
136 TRCN0000201176 GCCAGAGAATTTACAGACAAA mouse 76416 Znrd1as pLKO.1 509 CDS 76% 73% N/A N/A
137 TRCN0000198345 GCTATTTGCAACCTCATCCTA mouse 66249 Pno1 pLKO.1 705 CDS 66% 72% N/A N/A
Download CSV

All hairpins matching current transcripts from this gene

(this is the union of the above two tables, provided here as a single download link)

Download CSV

ORFs matching current transcripts from this gene

No results found.