Gene: Luciferase

Identifier:
Hahn Lab -43
Official symbol:
Luciferase
Description:
Luciferase
Taxon:
CONTROL
Chromosome:
n/a
Wildtype Transcripts:
Luciferase.1

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -43 (Luciferase), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072247 GAATCGTCGTATGCAGTGAAA pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
2 TRCN0000231720 GAATCGTCGTATGCAGTGAAA pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
3 TRCN0000072255 TCTACTGGTCTGCCTAAAGGT pLKO.1 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
4 TRCN0000231734 TCTACTGGTCTGCCTAAAGGT pLKO_TRC005 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
5 TRCN0000072251 GAGTACTTCGAAATGTCCGTT pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
6 TRCN0000231728 GAGTACTTCGAAATGTCCGTT pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
7 TRCN0000072264 GCTGAGTACTTCGAAATGTCC pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
8 TRCN0000231741 GCTGAGTACTTCGAAATGTCC pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -43 (Luciferase), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

shRNA constructs originally designed to target this gene, but which may no longer match it

No results found.

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464768 CONTROL Luciferase.1 -43 Luciferase pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
2 ccsbBroad301_99992 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
3 ccsbBroad301_99993 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
4 ccsbBroad301_99991 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
5 ccsbBroad301_99982 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 99.8% 99.8% None 1651_1653delTTG
6 ccsbBroad304_99991 CONTROL Luciferase.1 -43 Luciferase pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
7 ccsbBroad304_99992 CONTROL Luciferase.1 -43 Luciferase pLX_TRC304 18.9% 99.8% 99.8% V5 1651_1653delTTG
8 BRDN0000559440 CONTROL Luciferase.1 -43 Luciferase pLX_TRC307 0% 99.8% 99.8% V5 1651_1653delTTG
9 BRDN0000464779 CONTROL Luciferase.1 -43 Luciferase pLX_TRC302 0% 99.8% 99.8% V5 1651_1653delTTG
10 BRDN0000556282 CONTROL Luciferase.1 -43 Luciferase pLX_TRC303 0% 99.8% 99.8% None 1651_1653delTTG
11 BRDN0000556262 CONTROL Luciferase.1 -43 Luciferase pLX_TRC305 0% 99.8% 99.8% None 1651_1653delTTG
12 BRDN0000556299 CONTROL Luciferase.1 -43 Luciferase pLX_TRC306 0% 99.8% 99.8% V5 1651_1653delTTG
13 BRDN0000556280 CONTROL Luciferase.1 -43 Luciferase pLXI_TRC401 0% 99.8% 99.8% None 1651_1653delTTG
14 BRDN0000556275 CONTROL Luciferase.1 -43 Luciferase pLXI_TRC402 0% 99.8% 99.8% HA 1651_1653delTTG
15 BRDN0000556301 CONTROL Luciferase.1 -43 Luciferase pLX_TRC311 0% 99.8% 99.8% V5 1651_1653delTTG
16 BRDN0000556296 CONTROL Luciferase.1 -43 Luciferase pLX_TRC312 0% 99.8% 99.8% V5 1651_1653delTTG
17 BRDN0000556302 CONTROL Luciferase.1 -43 Luciferase pLX_TRC313 0% 99.8% 99.8% V5 1651_1653delTTG
18 BRDN0000556293 CONTROL Luciferase.1 -43 Luciferase pLX_TRC314 0% 99.8% 99.8% V5 1651_1653delTTG
19 BRDN0000556270 CONTROL Luciferase.1 -43 Luciferase pLX_TRC315 0% 99.8% 99.8% V5 1651_1653delTTG
20 BRDN0000556289 CONTROL Luciferase.1 -43 Luciferase pLXI_TRC403 0% 99.8% 99.8% V5 1651_1653delTTG
21 ccsbBroad304_99993 CONTROL Luciferase.1 -43 Luciferase pLX_TRC304 44.2% 76.6% 56.4% V5 (not translated due to prior stop codon) (many diffs)
22 BRDN0000464769 CONTROL Luciferase.1 -43 Luciferase pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
23 BRDN0000464770 CONTROL Luciferase.1 -43 Luciferase pDONR223 0% 99.8% 99.8% None 1651_1653delTTG
Download CSV