Gene: LacZ

Identifier:
Hahn Lab -42
Official symbol:
LacZ
Description:
LacZ
Taxon:
CONTROL
Chromosome:
n/a
Wildtype Transcripts:
LacZ.1

Hairpins designed to target transcripts from this gene

No results found.

All "non-targeting" hairpins matching current transcripts from this gene

This list includes shRNAs that were designed to match transcripts from a gene other than the queried gene yet have a significant match to the queried gene. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000072223 TGTTCGCATTATCCGAACCAT CONTROL -15 lacZ pLKO.1 1168 CDS 100% 100% 0.300 N/A
2 TRCN0000072224 CGCGATCGTAATCACCCGAGT CONTROL -15 lacZ pLKO.1 1339 CDS 100% 100% 0.720 N/A
3 TRCN0000072226 CGATCGTAATCACCCGAGTGT CONTROL -15 lacZ pLKO.1 1341 CDS 100% 100% 2.640 N/A
4 TRCN0000072227 GCGCTAATCACGACGCGCTGT CONTROL -15 lacZ pLKO.1 1397 CDS 100% 100% 0.000 N/A
5 TRCN0000072229 GCGATCGTAATCACCCGAGTG CONTROL -15 lacZ pLKO.1 1340 CDS 100% 100% 0.750 N/A
6 TRCN0000072230 CCCGTCAGTATCGGCGGAATT CONTROL -15 lacZ pLKO.1 3003 CDS 100% 100% 0.000 N/A
7 TRCN0000072231 CGCTAAATACTGGCAGGCGTT CONTROL -15 lacZ pLKO.1 1650 CDS 100% 100% 2.160 N/A
8 TRCN0000072236 CCAACGTGACCTATCCCATTA CONTROL -15 lacZ pLKO.1 305 CDS 100% 100% 10.800 N/A
9 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT CONTROL -15 lacZ pLKO.1 816 CDS 100% 100% 0.000 N/A
10 TRCN0000072238 GTTCCGTCATAGCGATAACGA CONTROL -15 lacZ pLKO.1 1932 CDS 100% 100% 3.000 N/A
11 TRCN0000072241 GCGTTGGCAATTTAACCGCCA CONTROL -15 lacZ pLKO.1 2265 CDS 100% 100% 0.540 N/A
12 TRCN0000072242 GTCGGCTTACGGCGGTGATTT CONTROL -15 lacZ pLKO.1 1758 CDS 100% 100% 4.400 N/A
13 TRCN0000231726 TGTTCGCATTATCCGAACCAT CONTROL -15 lacZ pLKO_TRC005 1168 CDS 100% 100% 0.300 N/A
14 TRCN0000231722 CGCGATCGTAATCACCCGAGT CONTROL -15 lacZ pLKO_TRC005 1339 CDS 100% 100% 0.720 N/A
15 TRCN0000231709 CGATCGTAATCACCCGAGTGT CONTROL -15 lacZ pLKO_TRC005 1341 CDS 100% 100% 2.640 N/A
16 TRCN0000231708 GCGCTAATCACGACGCGCTGT CONTROL -15 lacZ pLKO_TRC005 1397 CDS 100% 100% 0.000 N/A
17 TRCN0000231712 GCGATCGTAATCACCCGAGTG CONTROL -15 lacZ pLKO_TRC005 1340 CDS 100% 100% 0.750 N/A
18 TRCN0000231711 CCCGTCAGTATCGGCGGAATT CONTROL -15 lacZ pLKO_TRC005 3003 CDS 100% 100% 0.000 N/A
19 TRCN0000231710 CGCTAAATACTGGCAGGCGTT CONTROL -15 lacZ pLKO_TRC005 1650 CDS 100% 100% 2.160 N/A
20 TRCN0000231735 CCAACGTGACCTATCCCATTA CONTROL -15 lacZ pLKO_TRC005 305 CDS 100% 100% 10.800 N/A
21 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT CONTROL -15 lacZ pLKO_TRC005 816 CDS 100% 100% 0.000 N/A
22 TRCN0000231685 GTTCCGTCATAGCGATAACGA CONTROL -15 lacZ pLKO_TRC005 1932 CDS 100% 100% 3.000 N/A
23 TRCN0000231704 GCGTTGGCAATTTAACCGCCA CONTROL -15 lacZ pLKO_TRC005 2265 CDS 100% 100% 0.540 N/A
24 TRCN0000231706 GTCGGCTTACGGCGGTGATTT CONTROL -15 lacZ pLKO_TRC005 1758 CDS 100% 100% 4.400 N/A
25 TRCN0000072235 CCGTCATAGCGATAACGAGTT CONTROL -15 lacZ pLKO.1 1935 CDS 95% 100% 4.050 N/A
26 TRCN0000231738 CCGTCATAGCGATAACGAGTT CONTROL -15 lacZ pLKO_TRC005 1935 CDS 95% 100% 4.050 N/A
27 TRCN0000072232 CGTCGTATTACAACGTCGTGA CONTROL -15 lacZ pLKO.1 27 CDS 95% 94% N/A N/A
28 TRCN0000072240 TCGTATTACAACGTCGTGACT CONTROL -15 lacZ pLKO.1 29 CDS 95% 94% N/A N/A
29 TRCN0000231717 CGTCGTATTACAACGTCGTGA CONTROL -15 lacZ pLKO_TRC005 27 CDS 95% 94% N/A N/A
30 TRCN0000231702 TCGTATTACAACGTCGTGACT CONTROL -15 lacZ pLKO_TRC005 29 CDS 95% 94% N/A N/A
31 TRCN0000072225 CTCTGGCTAACGGTACGCGTA CONTROL -15 lacZ pLKO.1 2083 CDS 90% 89% N/A N/A
32 TRCN0000072228 ACTCTGGCTAACGGTACGCGT CONTROL -15 lacZ pLKO.1 2082 CDS 90% 89% N/A N/A
33 TRCN0000072233 CGACCACGCAAATCAGCGATT CONTROL -15 lacZ pLKO.1 656 CDS 90% 89% N/A N/A
34 TRCN0000072239 GCCGTCGTATTACAACGTCGT CONTROL -15 lacZ pLKO.1 25 CDS 90% 89% N/A N/A
35 TRCN0000231713 ACTCTGGCTAACGGTACGCGT CONTROL -15 lacZ pLKO_TRC005 2082 CDS 90% 89% N/A N/A
36 TRCN0000231716 CGACCACGCAAATCAGCGATT CONTROL -15 lacZ pLKO_TRC005 656 CDS 90% 89% N/A N/A
37 TRCN0000231700 GCCGTCGTATTACAACGTCGT CONTROL -15 lacZ pLKO_TRC005 25 CDS 90% 89% N/A N/A
38 TRCN0000072201 GTCGAGCTGGACGGCGACGTA CONTROL -10 GFP pLKO.1 49 CDS 73% 80% N/A N/A
39 TRCN0000156104 CCAACTTAATGGCTTGCAGTA human 10282 BET1 pLKO.1 549 3UTR 86% 90% N/A N/A
40 TRCN0000063939 CCGCTGGATCTGCCACTGTTT human 9253 NUMBL pLKO.1 710 CDS 81% 90% N/A N/A
41 TRCN0000056879 CGGCTTGCTTTCACAGATGTT human 4599 MX1 pLKO.1 1786 CDS 85% 89% N/A N/A
42 TRCN0000013367 GCGCTGAATTGCATTATGGAA human 9139 CBFA2T2 pLKO.1 1582 CDS 80% 89% N/A N/A
43 TRCN0000046251 GTGGATGAAGATCCAACCCAA human 2879 GPX4 pLKO.1 515 CDS 80% 89% N/A N/A
44 TRCN0000133673 GAATACCTGAAACTGTGGATT human 83640 FAM103A1 pLKO.1 717 3UTR 80% 89% N/A N/A
45 TRCN0000300410 GTGGATGAAGATCCAACCCAA human 2879 GPX4 pLKO_TRC005 542 CDS 80% 89% N/A N/A
46 TRCN0000057086 GCGTGGAGATGACCACGCCCT human 3543 IGLL1 pLKO.1 594 CDS 86% 85% N/A N/A
47 TRCN0000155936 CTTGCTGGATGAGCAGAACAA human 55954 ZMAT5 pLKO.1 277 CDS 86% 85% N/A N/A
48 TRCN0000172611 GCAGAAGAAGACAATGGCTGA human 79140 CCDC28B pLKO.1 577 CDS 86% 85% N/A N/A
49 TRCN0000319227 CTTGCTGGATGAGCAGAACAA human 55954 ZMAT5 pLKO_TRC005 277 CDS 86% 85% N/A N/A
50 TRCN0000296270 CAGTCAAGCAGCAAGATGGAG human 84316 LSMD1 pLKO_TRC005 506 CDS 82% 85% N/A N/A
51 TRCN0000033807 GCCTGCTTGTACAAATGGTTT human 26046 LTN1 pLKO.1 5328 CDS 81% 85% N/A N/A
52 TRCN0000038597 GAGGCTTCTCTCACAGATGTT human 162515 SLC16A11 pLKO.1 370 CDS 81% 85% N/A N/A
53 TRCN0000045809 GCTAGATCCAAATCTTCGATA human 9791 PTDSS1 pLKO.1 498 CDS 81% 85% N/A N/A
54 TRCN0000107216 CGCCGTGAAAGCTGGTGGAAT human 1611 DAP pLKO.1 210 CDS 81% 85% N/A N/A
55 TRCN0000158349 CGGCAGCTGATGTGAAGAATA human 65082 VPS33A pLKO.1 277 CDS 81% 85% N/A N/A
56 TRCN0000337008 CCTTCCTGCTGGTGCAGTATT human 8303 SNN pLKO_TRC005 357 CDS 81% 85% N/A N/A
57 TRCN0000338732 AGCGGACTTTCCGTGACATTT human 23731 TMEM245 pLKO_TRC005 2623 CDS 81% 85% N/A N/A
58 TRCN0000290942 GCTAGATCCAAATCTTCGATA human 9791 PTDSS1 pLKO_TRC005 498 CDS 81% 85% N/A N/A
59 TRCN0000322808 CCACTTGTTCCCACGAGAATA human 55968 NSFL1C pLKO_TRC005 2431 3UTR 81% 85% N/A N/A
60 TRCN0000417704 GGTGGTTAAAGCCATATTGGA human 8926 SNURF pLKO_TRC005 334 CDS 81% 85% N/A N/A
61 TRCN0000424848 GCCAGGGTCGAATCTGGAATG human 60598 KCNK15 pLKO_TRC005 1071 3UTR 81% 85% N/A N/A
62 TRCN0000061484 CGATGTACTCACGCTGGATAT human 9244 CRLF1 pLKO.1 869 CDS 77% 85% N/A N/A
63 TRCN0000136987 CTTGAGAAAGATGGCTACACA human 389383 CLPSL2 pLKO.1 231 CDS 77% 85% N/A N/A
64 TRCN0000139061 CAGGACTATGTGCAGATGAAG human 797 CALCB pLKO.1 236 CDS 77% 85% N/A N/A
65 TRCN0000157404 GATTGTGGAGACGGCTTCTAT human 254956 MORN5 pLKO.1 426 CDS 77% 85% N/A N/A
66 TRCN0000219668 CAGTGGTCGAATGGCATTAAG human 83942 TSSK1B pLKO.1 625 CDS 77% 85% N/A N/A
67 TRCN0000139358 CAGTTGATGAGCTGCTTGAGA human 400934 FLJ44385 pLKO.1 1529 CDS 77% 85% N/A N/A
68 TRCN0000236362 TCTGCCAGCTGGGCAAGTATA human 5916 RARG pLKO_TRC005 1096 CDS 77% 85% N/A N/A
69 TRCN0000246278 CTGCTGATGAGAAGTACAAAC human 388389 CCDC103 pLKO_TRC005 145 CDS 77% 85% N/A N/A
70 TRCN0000299639 CGATGTACTCACGCTGGATAT human 9244 CRLF1 pLKO_TRC005 860 CDS 77% 85% N/A N/A
71 TRCN0000440976 GAGATGATCGATGAGGTGGAC human 7134 TNNC1 pLKO_TRC005 201 CDS 77% 85% N/A N/A
72 TRCN0000445541 CCATGTTCCACTCGCTCTTTG human 51399 TRAPPC4 pLKO_TRC005 603 CDS 77% 85% N/A N/A
73 TRCN0000429060 CAAGCCCTTGTGATTCGAAAT human 476 ATP1A1 pLKO_TRC005 841 CDS 77% 85% N/A N/A
74 TRCN0000106981 CTACCATTCCAGCGTCTGGTA human 8968 HIST1H3F pLKO.1 198 CDS 79% 81% N/A N/A
75 TRCN0000165969 GCAACTGAGAAACAGCCAGAT human 440313 LOC440313 pLKO.1 2836 3UTR 75% 81% N/A N/A
76 TRCN0000038615 GAAGAAGCTCAGGCTGAAATT human 9550 ATP6V1G1 pLKO.1 205 CDS 78% 80% N/A N/A
77 TRCN0000083640 CGTTACCATTGGCTGGTCTTA human 54840 APTX pLKO.1 677 CDS 78% 80% N/A N/A
78 TRCN0000118023 CAGTGCTGATCTTCCAGGCCT human 10410 IFITM3 pLKO.1 611 CDS 78% 80% N/A N/A
79 TRCN0000135792 CCTGGTGAGAAGAGAACATTT human 79608 RIC3 pLKO.1 1601 3UTR 78% 80% N/A N/A
80 TRCN0000129528 GCCATCTTGCACTCAGAAGAT human 119032 C10orf32 pLKO.1 213 CDS 78% 80% N/A N/A
81 TRCN0000146377 CGTTCTTGACAAATGGGTGAA human 64083 GOLPH3 pLKO.1 945 CDS 78% 80% N/A N/A
82 TRCN0000155165 GCCACTGTTGAAACCACCATT human 22998 LIMCH1 pLKO.1 1555 CDS 78% 80% N/A N/A
83 TRCN0000263719 CATGTTCCCAGCTCGTTAATA human 113444 C1orf212 pLKO_TRC005 1321 3UTR 78% 80% N/A N/A
84 TRCN0000273315 ATGTGGGATGAGACGGAATTG human 29128 UHRF1 pLKO_TRC005 708 CDS 78% 80% N/A N/A
85 TRCN0000327872 GAAGAAGCTCAGGCTGAAATT human 9550 ATP6V1G1 pLKO_TRC005 237 CDS 78% 80% N/A N/A
86 TRCN0000344327 GCCACTGTTGAAACCACCATT human 22998 LIMCH1 pLKO_TRC005 1555 CDS 78% 80% N/A N/A
87 TRCN0000047494 CGGCAGAACATTGCTTATGAA human 10788 IQGAP2 pLKO.1 319 CDS 73% 80% N/A N/A
88 TRCN0000051292 CTGTGCTGAACGGACCGCTAT human 978 CDA pLKO.1 309 CDS 73% 80% N/A N/A
89 TRCN0000063752 GCTGCGGAAGAAGAGGCCATA human 2055 CLN8 pLKO.1 1074 CDS 73% 80% N/A N/A
90 TRCN0000135728 CCGTTGATCTTAGTGGTGAAA human 51105 PHF20L1 pLKO.1 2337 3UTR 73% 80% N/A N/A
91 TRCN0000142646 GCTGGAATCCTCTTCCTGAAA human 29075 HSPC072 pLKO.1 567 CDS 73% 80% N/A N/A
92 TRCN0000195604 CAGTACCAGTGTTTGGTGTTT human 558 AXL pLKO.1 798 CDS 73% 80% N/A N/A
93 TRCN0000122565 CGGCTGAAGGTCATGTGCGAA human 339745 SPOPL pLKO.1 460 CDS 73% 80% N/A N/A
94 TRCN0000245668 GCCGCTCATCAACACCTACAT human 126003 TRAPPC5 pLKO_TRC005 524 CDS 73% 80% N/A N/A
95 TRCN0000282829 CCAAGAAGGCACATCTGAAAC human 143379 C10orf82 pLKO_TRC005 486 CDS 73% 80% N/A N/A
96 TRCN0000053190 CCCAACTATTGCCGCAGCAAA human 55718 POLR3E pLKO.1 355 CDS 76% 78% N/A N/A
97 TRCN0000158264 CCTGCTGGAAGACAAGAACTT human 255101 CCDC108 pLKO.1 2956 CDS 79% 77% N/A N/A
98 TRCN0000373067 TGAGCTGAAGAGTGAGGATAT human 4340 MOG pLKO_TRC005 1168 3UTR 79% 77% N/A N/A
99 TRCN0000369769 CCTTCGGGTACATTCTCTATG human 89944 GLB1L2 pLKO_TRC005 1468 CDS 79% 77% N/A N/A
100 TRCN0000061987 CAAATGGATGAAATACGGTTA human 946 SIGLEC6 pLKO.1 537 CDS 75% 77% N/A N/A
101 TRCN0000155722 CGATACACAGAATCGCCAGAT human 6616 SNAP25 pLKO.1 725 CDS 75% 77% N/A N/A
102 TRCN0000204211 CATGGTGGTATGGCTGAACAA human 51537 MTFP1 pLKO.1 1111 3UTR 75% 77% N/A N/A
103 TRCN0000242115 CCCAATATCGCAGACCGATTA human 284615 ANKRD34A pLKO_TRC005 1501 CDS 75% 77% N/A N/A
104 TRCN0000343625 CGATACACAGAATCGCCAGAT human 6616 SNAP25 pLKO_TRC005 725 CDS 75% 77% N/A N/A
105 TRCN0000055897 CCTGGCGGAAATCAGTGTATT human 2200 FBN1 pLKO.1 356 CDS 70% 77% N/A N/A
106 TRCN0000141887 GATGAATGACTCCAGGAAGAA human 797 CALCB pLKO.1 461 3UTR 70% 77% N/A N/A
107 TRCN0000142526 GTTCTGAAGAACTCTGGCCAA human 257000 PLAC2 pLKO.1 1158 3UTR 70% 77% N/A N/A
108 TRCN0000286663 CCTGGCGGAAATCAGTGTATT human 2200 FBN1 pLKO_TRC005 551 CDS 70% 77% N/A N/A
109 TRCN0000036702 TCTGGGAAACTGGCGTGACAA human 401897 LOC401897 pLKO.1 375 CDS 70% 77% N/A N/A
110 TRCN0000008642 CCTTGCCCGCTCGGGTATGAA human 6208 RPS14 pLKO.1 410 CDS 76% 73% N/A N/A
111 TRCN0000277903 CCTTGCCCGCTCGGGTATGAA human 6208 RPS14 pLKO_TRC005 410 CDS 76% 73% N/A N/A
112 TRCN0000418344 CACACACCACCACCGTATTAT human 222484 LNX2 pLKO_TRC005 1636 CDS 76% 73% N/A N/A
113 TRCN0000052698 GCCATGTCAGTTTATACCTTA human 51205 ACP6 pLKO.1 1645 CDS 68% 73% N/A N/A
114 TRCN0000121821 GATGAAGACAACTTGAACTAT human 139425 DCAF8L1 pLKO.1 1712 CDS 68% 73% N/A N/A
115 TRCN0000289154 GCCATGTCAGTTTATACCTTA human 51205 ACP6 pLKO_TRC005 1665 CDS 68% 73% N/A N/A
116 TRCN0000027859 CGACTTCCTGTTCAACATCTT mouse 14747 Cmklr1 pLKO.1 510 CDS 85% 94% N/A N/A
117 TRCN0000322397 AGATGTGGATGGCGAGAAATA mouse 66230 Mrps28 pLKO_TRC005 405 CDS 86% 90% N/A N/A
118 TRCN0000023297 CGCTGCCAAGACGGTGAAGTT mouse 14182 Fgfr1 pLKO.1 564 CDS 85% 89% N/A N/A
119 TRCN0000436725 CAACTGCTGACGCAGCTTCTT mouse 50518 a pLKO_TRC005 469 CDS 80% 89% N/A N/A
120 TRCN0000279373 TTCACCCATCACCGCTGATAA mouse 105203 BC016423 pLKO_TRC005 3565 CDS 86% 85% N/A N/A
121 TRCN0000338054 GCCGTTGTTCCCACGAATAAT mouse 17245 Mdm1 pLKO_TRC005 702 CDS 86% 85% N/A N/A
122 TRCN0000374404 CGCTGTACTCTGGAGCAAATC mouse 232944 Mark4 pLKO_TRC005 892 CDS 86% 85% N/A N/A
123 TRCN0000039524 GCTCACTTAAGGTTGATGATA mouse 66743 Rnf220 pLKO.1 874 CDS 82% 85% N/A N/A
124 TRCN0000026093 GCTGTGTCGTCTGGTCAAATA mouse 18430 Oxtr pLKO.1 330 CDS 81% 85% N/A N/A
125 TRCN0000124665 GCTTCCTTTCAAGATCGTGGT mouse 18203 Ntan1 pLKO.1 651 CDS 81% 85% N/A N/A
126 TRCN0000251674 TACTAGCAGATGCAGGTTATG mouse 70166 Lipn pLKO_TRC005 553 CDS 81% 85% N/A N/A
127 TRCN0000312286 GCTTCCTTTCAAGATCGTGGT mouse 18203 Ntan1 pLKO_TRC005 653 CDS 81% 85% N/A N/A
128 TRCN0000437524 CCACTCAGCTTTCAGATGATG mouse 216150 Cdc34 pLKO_TRC005 1112 3UTR 81% 85% N/A N/A
129 TRCN0000031806 TGCCATGTCAGCCAGTATAAT mouse 16613 Klk1b11 pLKO.1 222 CDS 78% 85% N/A N/A
130 TRCN0000098399 GTGTGATCATTGGTTGCAGCA mouse 70831 Krtap31-1 pLKO.1 449 CDS 77% 85% N/A N/A
131 TRCN0000126111 GCATCCGCCATTGTAGACAAT mouse 74775 Lmbr1l pLKO.1 692 CDS 77% 85% N/A N/A
132 TRCN0000179007 CGAAGGACATTGTTGCAGTAT mouse 225523 Cep120 pLKO.1 585 CDS 77% 85% N/A N/A
133 TRCN0000173359 GAACTTCCTTACTACCGCATA mouse 381886 Mrgpra6 pLKO.1 486 CDS 77% 85% N/A N/A
134 TRCN0000248466 ACCCGAGATGTATCATCTAAG mouse 57896 Krcc1 pLKO_TRC005 1070 CDS 77% 85% N/A N/A
135 TRCN0000311572 CAAGCCCTTGTGATTCGAAAT mouse 11928 Atp1a1 pLKO_TRC005 754 CDS 77% 85% N/A N/A
136 TRCN0000376957 GAAGATGGTGCTGGTATCCAC mouse 170759 Atp13a1 pLKO_TRC005 3625 3UTR 77% 85% N/A N/A
137 TRCN0000041158 CCACTCTTAATGTGATTTCTT mouse 51902 Rnf24 pLKO.1 2782 3UTR 76% 82% N/A N/A
138 TRCN0000124181 GCTGATCCTTTACTACGCCTT mouse 58239 Dexi pLKO.1 465 CDS 75% 81% N/A N/A
139 TRCN0000302503 GCTGATCCTTTACTACGCCTT mouse 58239 Dexi pLKO_TRC005 478 CDS 75% 81% N/A N/A
140 TRCN0000091308 CCTGCATTTACCACCAGGAAA mouse 434902 LOC434902 pLKO.1 194 CDS 82% 80% N/A N/A
141 TRCN0000328195 CATCAGGGAAGCCTTACTTAT mouse 113853 Vmn1r53 pLKO_TRC005 570 CDS 82% 80% N/A N/A
142 TRCN0000030801 GCATGGTACAAGATGGATGAT mouse 13532 Usp17l5 pLKO.1 974 CDS 78% 80% N/A N/A
143 TRCN0000221440 CCAAGGCATGTGCAACGAATA mouse 30800 Mmp20 pLKO.1 1181 CDS 78% 80% N/A N/A
144 TRCN0000182727 GCCATCTTACACTCGGAAGAT mouse 66439 2010012O05Rik pLKO.1 223 CDS 78% 80% N/A N/A
145 TRCN0000244260 GGATTGAGCAGTGGGTCAAAG mouse 108143 Taf9 pLKO_TRC005 560 CDS 78% 80% N/A N/A
146 TRCN0000281839 TCTGATAAGCGACCAACTTAA mouse 80902 Zfp202 pLKO_TRC005 2475 3UTR 78% 80% N/A N/A
147 TRCN0000366062 GACTGGAAACCCTGACTTTAT mouse 18746 Pkm2 pLKO_TRC005 1861 3UTR 78% 80% N/A N/A
148 TRCN0000375474 CGTCATGATAGGAGACGATTG mouse 76987 Hdhd2 pLKO_TRC005 678 CDS 78% 80% N/A N/A
149 TRCN0000067771 CCAGCAGGTCTTTACCAGTAT mouse 14130 Fcgr2b pLKO.1 674 CDS 73% 80% N/A N/A
150 TRCN0000114175 GCGAATCTGTTCCCTTATAAA mouse 67895 Ppa1 pLKO.1 352 CDS 73% 80% N/A N/A
151 TRCN0000179866 CCACAAGAAATATCCCGAGAA mouse 70208 Med23 pLKO.1 2833 CDS 73% 80% N/A N/A
152 TRCN0000238608 CCAACAGCAACTGGGAAATAT mouse 229571 Gm4858 pLKO_TRC005 953 3UTR 73% 80% N/A N/A
153 TRCN0000247394 TAGTCACCACTGTGATCATTG mouse 245532 Awat2 pLKO_TRC005 110 CDS 73% 80% N/A N/A
154 TRCN0000313993 ACGAAGAGGCCCACCGATTAT mouse 69072 Ebna1bp2 pLKO_TRC005 504 CDS 73% 80% N/A N/A
155 TRCN0000313550 AGAAGCCCGTCGTCGGTTTAA mouse 19155 Npepps pLKO_TRC005 2290 CDS 73% 80% N/A N/A
156 TRCN0000341854 CCACAAGAAATATCCCGAGAA mouse 70208 Med23 pLKO_TRC005 2833 CDS 73% 80% N/A N/A
157 TRCN0000309313 GCGAATCTGTTCCCTTATAAA mouse 67895 Ppa1 pLKO_TRC005 351 CDS 73% 80% N/A N/A
158 TRCN0000089399 GCAGTGGTTGATGAACACCAA mouse 14526 Gcg pLKO.1 326 CDS 73% 80% N/A N/A
159 TRCN0000222640 GCCAGTCTGATGAAGGTTCAA mouse 26565 Pla2g10 pLKO.1 793 3UTR 73% 80% N/A N/A
160 TRCN0000075939 CCCTTCAACATTGCCAGCTAT mouse 22171 Tyms pLKO.1 687 CDS 72% 78% N/A N/A
161 TRCN0000112364 CTGGAAGTGAAGAGATGTGTA mouse 114895 Psbpc1 pLKO.1 187 CDS 72% 78% N/A N/A
162 TRCN0000317508 CCCTTCAACATTGCCAGCTAT mouse 22171 Tyms pLKO_TRC005 686 CDS 72% 78% N/A N/A
163 TRCN0000240117 ATCAGCTACATCAAGCAACTG mouse 67341 Ascl4 pLKO_TRC005 358 CDS 79% 77% N/A N/A
164 TRCN0000082310 GCCAGGATCTTCTGCCGTCTT mouse 231991 Creb5 pLKO.1 166 CDS 75% 77% N/A N/A
165 TRCN0000093104 GCTGCTGGAAGAGAATAACTA mouse 76653 Cby3 pLKO.1 774 CDS 75% 77% N/A N/A
166 TRCN0000111370 AGCTGAAAGAAGCGTTGCTTA mouse 20022 Polr2j pLKO.1 372 3UTR 75% 77% N/A N/A
167 TRCN0000111587 CCAGTTCAAGATCGGTCTGAT mouse 56433 Vps29 pLKO.1 295 CDS 75% 77% N/A N/A
168 TRCN0000332516 AGCTGAAAGAAGCGTTGCTTA mouse 20022 Polr2j pLKO_TRC005 418 3UTR 75% 77% N/A N/A
169 TRCN0000097274 GCTGGGATGATCAAGCCATTT mouse 18783 Pla2g4a pLKO.1 2415 3UTR 70% 77% N/A N/A
170 TRCN0000102925 GCTGCCATTAGAGATGTATTT mouse 108043 Chrnb3 pLKO.1 1722 3UTR 70% 77% N/A N/A
171 TRCN0000104248 TGGTGCATCTCTTGCTGATAT mouse 68193 Rpl24 pLKO.1 291 CDS 70% 77% N/A N/A
172 TRCN0000108917 TCTGCCAACTACCGAGCCTAT mouse 21954 Tnni3 pLKO.1 198 CDS 70% 77% N/A N/A
173 TRCN0000111559 GCTGATGAACAGAGCCTTGTT mouse 65114 Vps35 pLKO.1 1518 CDS 70% 77% N/A N/A
174 TRCN0000193931 CCATCATCCTTATGGTCAGTA mouse 231549 Lrrc8d pLKO.1 925 CDS 70% 77% N/A N/A
175 TRCN0000318221 GCTGATGAACAGAGCCTTGTT mouse 65114 Vps35 pLKO_TRC005 1493 CDS 70% 77% N/A N/A
176 TRCN0000335307 GCTGGGATGATCAAGCCATTT mouse 18783 Pla2g4a pLKO_TRC005 2415 3UTR 70% 77% N/A N/A
177 TRCN0000126101 CCTACAGGAAAGACGCAGAAT mouse 58866 Treh pLKO.1 880 CDS 76% 73% N/A N/A
178 TRCN0000127431 CACCACACAATCAATTTCCAT mouse 231986 Jazf1 pLKO.1 699 CDS 76% 73% N/A N/A
179 TRCN0000366470 TGAACAGCAAGTCCGTGATTC mouse 18969 Pola2 pLKO_TRC005 1096 CDS 76% 73% N/A N/A
180 TRCN0000419127 TGCAGGAACAGACCCGATTAT mouse 104175 Sbk1 pLKO_TRC005 2195 3UTR 76% 73% N/A N/A
181 TRCN0000267961 GACAGGAAAGAAGCGAATTAC mouse 68736 1110034B05Rik pLKO_TRC005 726 CDS 72% 73% N/A N/A
182 TRCN0000104401 GCACGGATACATTGGTGAATT mouse 267019 Rps15a pLKO.1 146 CDS 68% 73% N/A N/A
183 TRCN0000374491 TGCAACCGGAACCGCATTGAG mouse 329731 Fam19a3 pLKO_TRC005 749 CDS 68% 73% N/A N/A
184 TRCN0000420061 AGATCTGGTCAGAATGTATTG mouse 74245 Ctbs pLKO_TRC005 602 CDS 66% 72% N/A N/A
Download CSV

All hairpins matching current transcripts from this gene

(this is the union of the above two tables, provided here as a single download link)

Download CSV

ORFs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464771 CONTROL LacZ.1 -42 LacZ pDONR223 0% 99.9% 99.9% None 3205_3207delTTG
2 ccsbBroad301_99994 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 99.9% 99.9% None 3205_3207delTTG
3 ccsbBroad301_99995 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 99.9% 99.9% None 3205_3207delTTG
4 ccsbBroad301_99996 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 99.9% 99.9% None 3205_3207delTTG
5 ccsbBroad301_99983 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 99.9% 99.9% None 3205_3207delTTG
6 ccsbBroad304_99994 CONTROL LacZ.1 -42 LacZ pLX_TRC304 3.4% 99.9% 99.9% V5 3205_3207delTTG
7 ccsbBroad304_99996 CONTROL LacZ.1 -42 LacZ pLX_TRC304 3.4% 99.9% 99.9% V5 3205_3207delTTG
8 ccsbBroad304_99995 CONTROL LacZ.1 -42 LacZ pLX_TRC304 3.4% 99.9% 99.9% V5 3205_3207delTTG
9 BRDN0000559441 CONTROL LacZ.1 -42 LacZ pLX_TRC307 0% 99.9% 99.9% V5 3205_3207delTTG
10 BRDN0000464780 CONTROL LacZ.1 -42 LacZ pLX_TRC302 0% 99.9% 99.9% V5 3205_3207delTTG
11 BRDN0000556272 CONTROL LacZ.1 -42 LacZ pLX_TRC303 0% 99.9% 99.9% None 3205_3207delTTG
12 BRDN0000556278 CONTROL LacZ.1 -42 LacZ pLX_TRC305 0% 99.9% 99.9% None 3205_3207delTTG
13 BRDN0000556288 CONTROL LacZ.1 -42 LacZ pLX_TRC306 0% 99.9% 99.9% V5 3205_3207delTTG
14 BRDN0000556266 CONTROL LacZ.1 -42 LacZ pLXI_TRC401 0% 99.9% 99.9% None 3205_3207delTTG
15 BRDN0000556290 CONTROL LacZ.1 -42 LacZ pLXI_TRC402 0% 99.9% 99.9% HA 3205_3207delTTG
16 BRDN0000556291 CONTROL LacZ.1 -42 LacZ pLX_TRC311 0% 99.9% 99.9% V5 3205_3207delTTG
17 BRDN0000556274 CONTROL LacZ.1 -42 LacZ pLX_TRC312 0% 99.9% 99.9% V5 3205_3207delTTG
18 BRDN0000556300 CONTROL LacZ.1 -42 LacZ pLX_TRC313 0% 99.9% 99.9% V5 3205_3207delTTG
19 BRDN0000556279 CONTROL LacZ.1 -42 LacZ pLX_TRC314 0% 99.9% 99.9% V5 3205_3207delTTG
20 BRDN0000556294 CONTROL LacZ.1 -42 LacZ pLX_TRC315 0% 99.9% 99.9% V5 3205_3207delTTG
21 BRDN0000556277 CONTROL LacZ.1 -42 LacZ pLXI_TRC403 0% 99.9% 99.9% V5 3205_3207delTTG
22 BRDN0000464772 CONTROL LacZ.1 -42 LacZ pDONR223 0% 99.9% 99.9% None 3205_3207delTTG
23 BRDN0000464773 CONTROL LacZ.1 -42 LacZ pDONR223 0% 99.9% 99.9% None 3205_3207delTTG
Download CSV