Gene: LacZ

Hahn Lab -42
Official symbol:
Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -42 (LacZ), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072236 CCAACGTGACCTATCCCATTA pLKO.1 LacZ.1 CDS 100% 10.800 N/A N/A lacZ
2 TRCN0000231735 CCAACGTGACCTATCCCATTA pLKO_TRC005 LacZ.1 CDS 100% 10.800 N/A N/A lacZ
3 TRCN0000072242 GTCGGCTTACGGCGGTGATTT pLKO.1 LacZ.1 CDS 100% 4.400 N/A N/A lacZ
4 TRCN0000231706 GTCGGCTTACGGCGGTGATTT pLKO_TRC005 LacZ.1 CDS 100% 4.400 N/A N/A lacZ
5 TRCN0000072238 GTTCCGTCATAGCGATAACGA pLKO.1 LacZ.1 CDS 100% 3.000 N/A N/A lacZ
6 TRCN0000231685 GTTCCGTCATAGCGATAACGA pLKO_TRC005 LacZ.1 CDS 100% 3.000 N/A N/A lacZ
7 TRCN0000072226 CGATCGTAATCACCCGAGTGT pLKO.1 LacZ.1 CDS 100% 2.640 N/A N/A lacZ
8 TRCN0000231709 CGATCGTAATCACCCGAGTGT pLKO_TRC005 LacZ.1 CDS 100% 2.640 N/A N/A lacZ
9 TRCN0000072231 CGCTAAATACTGGCAGGCGTT pLKO.1 LacZ.1 CDS 100% 2.160 N/A N/A lacZ
10 TRCN0000231710 CGCTAAATACTGGCAGGCGTT pLKO_TRC005 LacZ.1 CDS 100% 2.160 N/A N/A lacZ
11 TRCN0000072229 GCGATCGTAATCACCCGAGTG pLKO.1 LacZ.1 CDS 100% 0.750 N/A N/A lacZ
12 TRCN0000231712 GCGATCGTAATCACCCGAGTG pLKO_TRC005 LacZ.1 CDS 100% 0.750 N/A N/A lacZ
13 TRCN0000072224 CGCGATCGTAATCACCCGAGT pLKO.1 LacZ.1 CDS 100% 0.720 N/A N/A lacZ
14 TRCN0000231722 CGCGATCGTAATCACCCGAGT pLKO_TRC005 LacZ.1 CDS 100% 0.720 N/A N/A lacZ
15 TRCN0000072241 GCGTTGGCAATTTAACCGCCA pLKO.1 LacZ.1 CDS 100% 0.540 N/A N/A lacZ
16 TRCN0000231704 GCGTTGGCAATTTAACCGCCA pLKO_TRC005 LacZ.1 CDS 100% 0.540 N/A N/A lacZ
17 TRCN0000072223 TGTTCGCATTATCCGAACCAT pLKO.1 LacZ.1 CDS 100% 0.300 N/A N/A lacZ
18 TRCN0000231726 TGTTCGCATTATCCGAACCAT pLKO_TRC005 LacZ.1 CDS 100% 0.300 N/A N/A lacZ
19 TRCN0000072230 CCCGTCAGTATCGGCGGAATT pLKO.1 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
20 TRCN0000231711 CCCGTCAGTATCGGCGGAATT pLKO_TRC005 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
21 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT pLKO.1 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
22 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT pLKO_TRC005 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
23 TRCN0000072227 GCGCTAATCACGACGCGCTGT pLKO.1 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
24 TRCN0000231708 GCGCTAATCACGACGCGCTGT pLKO_TRC005 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
25 TRCN0000072235 CCGTCATAGCGATAACGAGTT pLKO.1 LacZ.1 CDS 100% 4.050 N/A N/A lacZ
26 TRCN0000231738 CCGTCATAGCGATAACGAGTT pLKO_TRC005 LacZ.1 CDS 100% 4.050 N/A N/A lacZ
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -42 (LacZ), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

shRNA constructs originally designed to target this gene, but which may no longer match it

No results found.

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464771 CONTROL LacZ.1 -42 LacZ pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99994 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99995 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99996 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99983 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99994 CONTROL LacZ.1 -42 LacZ pLX_TRC304 3.4% 100% 100% V5 N/A
7 ccsbBroad304_99996 CONTROL LacZ.1 -42 LacZ pLX_TRC304 3.4% 100% 100% V5 N/A
8 ccsbBroad304_99995 CONTROL LacZ.1 -42 LacZ pLX_TRC304 3.4% 100% 100% V5 N/A
9 BRDN0000559441 CONTROL LacZ.1 -42 LacZ pLX_TRC307 0% 100% 100% V5 N/A
10 BRDN0000464780 CONTROL LacZ.1 -42 LacZ pLX_TRC302 0% 100% 100% V5 N/A
11 BRDN0000556272 CONTROL LacZ.1 -42 LacZ pLX_TRC303 0% 100% 100% None N/A
12 BRDN0000556278 CONTROL LacZ.1 -42 LacZ pLX_TRC305 0% 100% 100% None N/A
13 BRDN0000556288 CONTROL LacZ.1 -42 LacZ pLX_TRC306 0% 100% 100% V5 N/A
14 BRDN0000556266 CONTROL LacZ.1 -42 LacZ pLXI_TRC401 0% 100% 100% None N/A
15 BRDN0000556290 CONTROL LacZ.1 -42 LacZ pLXI_TRC402 0% 100% 100% HA N/A
16 BRDN0000556291 CONTROL LacZ.1 -42 LacZ pLX_TRC311 0% 100% 100% V5 N/A
17 BRDN0000556274 CONTROL LacZ.1 -42 LacZ pLX_TRC312 0% 100% 100% V5 N/A
18 BRDN0000556300 CONTROL LacZ.1 -42 LacZ pLX_TRC313 0% 100% 100% V5 N/A
19 BRDN0000556279 CONTROL LacZ.1 -42 LacZ pLX_TRC314 0% 100% 100% V5 N/A
20 BRDN0000556294 CONTROL LacZ.1 -42 LacZ pLX_TRC315 0% 100% 100% V5 N/A
21 BRDN0000556277 CONTROL LacZ.1 -42 LacZ pLXI_TRC403 0% 100% 100% V5 N/A
22 BRDN0000464772 CONTROL LacZ.1 -42 LacZ pDONR223 0% 100% 100% None N/A
23 BRDN0000464773 CONTROL LacZ.1 -42 LacZ pDONR223 0% 100% 100% None N/A
Download CSV