Gene: HcRed

Identifier:
Hahn Lab -41
Official symbol:
HcRed
Description:
HcRed
Taxon:
CONTROL
Chromosome:
n/a
Wildtype Transcripts:
HcRed.1

Hairpins designed to target transcripts from this gene

No results found.

All "non-targeting" hairpins matching current transcripts from this gene

This list includes shRNAs that were designed to match transcripts from a gene other than the queried gene yet have a significant match to the queried gene. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000072205 GCTCCGTGAACGGCCACGAGT CONTROL -12 RFP pLKO.1 59 CDS 85% 89% N/A N/A
2 TRCN0000231703 GCTCCGTGAACGGCCACGAGT CONTROL -12 RFP pLKO_TRC005 59 CDS 85% 89% N/A N/A
3 TRCN0000180582 GCTGAAGAAGAAGGAGGAGAA human 10814 CPLX2 pLKO.1 558 CDS 85% 89% N/A N/A
4 TRCN0000072598 ACTCCTGCAAGTGCGAGGGAT human 4504 MT3 pLKO.1 289 CDS 80% 89% N/A N/A
5 TRCN0000083072 GTGATGAAGGAACAAGAGGAT human 1302 COL11A2 pLKO.1 3325 CDS 80% 89% N/A N/A
6 TRCN0000232556 GCGGAGAGGAAGACGAGTATT human 90864 SPSB3 pLKO_TRC005 378 CDS 82% 85% N/A N/A
7 TRCN0000143019 CTTCTTCAACAAGCTTGCCTT human 138724 C9orf131 pLKO.1 710 CDS 78% 85% N/A N/A
8 TRCN0000013867 CAACTACTTCAGTGCGATGTA human 1999 ELF3 pLKO.1 3226 CDS 77% 85% N/A N/A
9 TRCN0000020365 GCATGAAGAGTACATGAAGAA human 55251 PCMTD2 pLKO.1 643 CDS 77% 85% N/A N/A
10 TRCN0000116373 CCCAGGCATGAAGAATCTATA human 51174 TUBD1 pLKO.1 615 CDS 77% 85% N/A N/A
11 TRCN0000122673 GCATCTGACCAAGCCCACCTT human 79701 C17orf101 pLKO.1 710 CDS 77% 85% N/A N/A
12 TRCN0000449804 CATCAGCTCCGGCAAGAAGAA human 51523 CXXC5 pLKO_TRC005 1046 CDS 75% 81% N/A N/A
13 TRCN0000199357 CCTGCGTCCATCACCGACATG human 169436 C9orf96 pLKO.1 1007 CDS 78% 80% N/A N/A
14 TRCN0000139499 CCCTGAGATGAAGAAAGAGCT human 54867 TMEM214 pLKO.1 1095 CDS 78% 80% N/A N/A
15 TRCN0000235498 GAGCGCAAGCCATGATCTATA human 8925 HERC1 pLKO_TRC005 7920 CDS 78% 80% N/A N/A
16 TRCN0000274839 CCGATGCCGGAACAAGAAGAA human 122953 JDP2 pLKO_TRC005 534 CDS 78% 80% N/A N/A
17 TRCN0000294421 GACACCACTGGAGGGTGACTT human 1026 CDKN1A pLKO_TRC005 290 CDS 78% 80% N/A N/A
18 TRCN0000051104 GCCACTACCAAGGGCGAGTAA human 80332 ADAM33 pLKO.1 428 CDS 73% 80% N/A N/A
19 TRCN0000151630 GAAGAATGAAGTGCTTCGATT human 84816 RTN4IP1 pLKO.1 428 CDS 73% 80% N/A N/A
20 TRCN0000140509 GCTTCCATCTCAGACATCCTT human 159013 CXorf38 pLKO.1 1013 3UTR 73% 80% N/A N/A
21 TRCN0000413407 TACAAGGAGGTGACGACACTG human 27338 UBE2S pLKO_TRC005 417 CDS 72% 78% N/A N/A
22 TRCN0000017845 CAGCCTGAAAGCAACTCTGAT human 58500 ZNF250 pLKO.1 1563 CDS 79% 77% N/A N/A
23 TRCN0000119056 CGAGAACTTCAAGTACGAGGA human 57716 PRX pLKO.1 485 CDS 75% 77% N/A N/A
24 TRCN0000369148 CCAGTTCACTGTCCGGCTCAA human 256302 C17orf103 pLKO_TRC005 86 CDS 75% 77% N/A N/A
25 TRCN0000055486 CTGCCTACTGAAGAGTATGAA human 54681 P4HTM pLKO.1 869 CDS 70% 77% N/A N/A
26 TRCN0000200177 CTGCGGAAGAAGAAGAAGGTA mouse 18100 Mrpl40 pLKO.1 262 CDS 80% 89% N/A N/A
27 TRCN0000081977 CAGATGCCGGAACAAGAAGAA mouse 81703 Jdp2 pLKO.1 492 CDS 82% 85% N/A N/A
28 TRCN0000112579 GAAGAAGAAGACGCCTACTTT mouse 239157 Pnma2 pLKO.1 1422 CDS 81% 85% N/A N/A
29 TRCN0000115109 GATGCTGCTAAGAAGGAGGAA mouse 12889 Cplx1 pLKO.1 202 CDS 81% 85% N/A N/A
30 TRCN0000192370 CGGAAGAGAAGGAAGAATATT mouse 171463 Il17rd pLKO.1 516 CDS 81% 85% N/A N/A
31 TRCN0000040810 CCCAAGAAGAAGGAGAGTAAA mouse 22194 Ube2e1 pLKO.1 277 CDS 77% 85% N/A N/A
32 TRCN0000100473 CCAGCTAACCAGACAAGAAAT mouse 50527 Ero1l pLKO.1 1324 CDS 77% 85% N/A N/A
33 TRCN0000302688 CCAGCTAACCAGACAAGAAAT mouse 50527 Ero1l pLKO_TRC005 1324 CDS 77% 85% N/A N/A
34 TRCN0000023976 GAAGGCAAGTATCGAGCTGAT mouse 22115 Tssk2 pLKO.1 892 CDS 75% 81% N/A N/A
35 TRCN0000086915 CCCGACTTCCAAGAAGAGGAT mouse 78688 Nol3 pLKO.1 795 CDS 78% 80% N/A N/A
36 TRCN0000182412 GCAGAAGACGAAGGAAGTACA mouse 331532 Tceal5 pLKO.1 233 CDS 78% 80% N/A N/A
37 TRCN0000175841 GAAGCAGAAACTGAGTACTCA mouse 20420 Shd pLKO.1 568 CDS 73% 80% N/A N/A
38 TRCN0000095637 GATGTACGAAGAGCACCTGAA mouse 66332 1700018B24Rik pLKO.1 143 CDS 79% 77% N/A N/A
39 TRCN0000098022 GAAGAAGAACTACTGCGAGTT mouse 319922 Vwc2 pLKO.1 768 CDS 75% 77% N/A N/A
40 TRCN0000096871 CGGCAGAGGATTCGTAAACTT mouse 140488 Igf2bp3 pLKO.1 471 CDS 70% 77% N/A N/A
41 TRCN0000430577 AGGAGAGTCCATGCCAAGATG mouse 73218 3110056O03Rik pLKO_TRC005 2220 3UTR 76% 73% N/A N/A
42 TRCN0000076312 CTGACGGAAGTGATCCTGAAA mouse 66590 Farsa pLKO.1 504 CDS 72% 73% N/A N/A
43 TRCN0000287495 CTGACGGAAGTGATCCTGAAA mouse 66590 Farsa pLKO_TRC005 542 CDS 72% 73% N/A N/A
Download CSV

All hairpins matching current transcripts from this gene

(this is the union of the above two tables, provided here as a single download link)

Download CSV

ORFs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464765 CONTROL HcRed.1 -41 HcRed pDONR223 0% 99.5% 99.5% None 685_687delTTG
2 ccsbBroad301_99989 CONTROL HcRed.1 -41 HcRed pLX_TRC301 0% 99.5% 99.5% None 685_687delTTG
3 ccsbBroad301_99990 CONTROL HcRed.1 -41 HcRed pLX_TRC301 0% 99.5% 99.5% None 685_687delTTG
4 ccsbBroad301_99988 CONTROL HcRed.1 -41 HcRed pLX_TRC301 0% 99.5% 99.5% None 685_687delTTG
5 ccsbBroad301_99981 CONTROL HcRed.1 -41 HcRed pLX_TRC301 0% 99.5% 99.5% None 685_687delTTG
6 ccsbBroad304_99990 CONTROL HcRed.1 -41 HcRed pLX_TRC304 75.8% 99.5% 99.5% V5 685_687delTTG
7 BRDN0000559442 CONTROL HcRed.1 -41 HcRed pLX_TRC307 0% 99.5% 99.5% V5 685_687delTTG
8 BRDN0000464778 CONTROL HcRed.1 -41 HcRed pLX_TRC302 0% 99.5% 99.5% V5 685_687delTTG
9 BRDN0000556267 CONTROL HcRed.1 -41 HcRed pLX_TRC303 0% 99.5% 99.5% None 685_687delTTG
10 BRDN0000556265 CONTROL HcRed.1 -41 HcRed pLX_TRC305 0% 99.5% 99.5% None 685_687delTTG
11 BRDN0000556269 CONTROL HcRed.1 -41 HcRed pLX_TRC306 0% 99.5% 99.5% V5 685_687delTTG
12 BRDN0000556261 CONTROL HcRed.1 -41 HcRed pLXI_TRC401 0% 99.5% 99.5% None 685_687delTTG
13 BRDN0000556287 CONTROL HcRed.1 -41 HcRed pLXI_TRC402 0% 99.5% 99.5% HA 685_687delTTG
14 BRDN0000556264 CONTROL HcRed.1 -41 HcRed pLX_TRC311 0% 99.5% 99.5% V5 685_687delTTG
15 BRDN0000556295 CONTROL HcRed.1 -41 HcRed pLX_TRC312 0% 99.5% 99.5% V5 685_687delTTG
16 BRDN0000556268 CONTROL HcRed.1 -41 HcRed pLX_TRC313 0% 99.5% 99.5% V5 685_687delTTG
17 BRDN0000556263 CONTROL HcRed.1 -41 HcRed pLX_TRC314 0% 99.5% 99.5% V5 685_687delTTG
18 BRDN0000556284 CONTROL HcRed.1 -41 HcRed pLX_TRC315 0% 99.5% 99.5% V5 685_687delTTG
19 BRDN0000556260 CONTROL HcRed.1 -41 HcRed pLXI_TRC403 0% 99.5% 99.5% V5 685_687delTTG
20 ccsbBroad304_99988 CONTROL HcRed.1 -41 HcRed pLX_TRC304 76.9% 69.8% 41.1% V5 (not translated due to prior stop codon) (many diffs)
21 BRDN0000464766 CONTROL HcRed.1 -41 HcRed pDONR223 0% 99.5% 99.5% None 685_687delTTG
22 BRDN0000464767 CONTROL HcRed.1 -41 HcRed pDONR223 0% 99.5% 99.5% None 685_687delTTG
Download CSV