Gene: BFP

Identifier:
Hahn Lab -40
Official symbol:
BFP
Description:
BFP
Taxon:
CONTROL
Chromosome:
n/a
Wildtype Transcripts:
BFP.1

Hairpins designed to target transcripts from this gene

No results found.

All "non-targeting" hairpins matching current transcripts from this gene

This list includes shRNAs that were designed to match transcripts from a gene other than the queried gene yet have a significant match to the queried gene. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same taxon.

Clone ID Target Seq Target Taxon[?] Target Gene[?] Target Gene Symbol Vector Match Position Match Region Match %[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?]
1 TRCN0000072178 CAACAGCCACAACGTCTATAT CONTROL -10 GFP pLKO.1 438 CDS 100% 100% 13.200 N/A
2 TRCN0000072179 CGACCACATGAAGCAGCACGA CONTROL -10 GFP pLKO.1 228 CDS 100% 100% 0.720 N/A
3 TRCN0000072180 CTATATCATGGCCGACAAGCA CONTROL -10 GFP pLKO.1 453 CDS 100% 100% 2.640 N/A
4 TRCN0000072182 TCTCGGCATGGACGAGCTGTA CONTROL -10 GFP pLKO.1 693 CDS 100% 100% 1.350 N/A
5 TRCN0000072183 CGGCATGGACGAGCTGTACAA CONTROL -10 GFP pLKO.1 696 CDS 100% 100% 1.650 N/A
6 TRCN0000072184 CGGGATCACTCTCGGCATGGA CONTROL -10 GFP pLKO.1 684 CDS 100% 100% 0.000 N/A
7 TRCN0000072187 CTCTCGGCATGGACGAGCTGT CONTROL -10 GFP pLKO.1 692 CDS 100% 100% 0.000 N/A
8 TRCN0000072188 CCCGACCACATGAAGCAGCAC CONTROL -10 GFP pLKO.1 226 CDS 100% 100% 0.000 N/A
9 TRCN0000072190 GACCACATGAAGCAGCACGAC CONTROL -10 GFP pLKO.1 229 CDS 100% 100% 0.720 N/A
10 TRCN0000072193 CGACGTAAACGGCCACAAGTT CONTROL -10 GFP pLKO.1 63 CDS 100% 100% 4.950 N/A
11 TRCN0000072194 CCACATGAAGCAGCACGACTT CONTROL -10 GFP pLKO.1 231 CDS 100% 100% 4.050 N/A
12 TRCN0000072195 GCGACGTAAACGGCCACAAGT CONTROL -10 GFP pLKO.1 62 CDS 100% 100% 1.650 N/A
13 TRCN0000072196 ACGTCTATATCATGGCCGACA CONTROL -10 GFP pLKO.1 449 CDS 100% 100% 2.160 N/A
14 TRCN0000072197 CTACGGCAAGCTGACCCTGAA CONTROL -10 GFP pLKO.1 117 CDS 100% 100% 1.350 N/A
15 TRCN0000072198 GCGCGATCACATGGTCCTGCT CONTROL -10 GFP pLKO.1 645 CDS 100% 100% 0.000 N/A
16 TRCN0000072199 TGACCCTGAAGTTCATCTGCA CONTROL -10 GFP pLKO.1 128 CDS 100% 100% 2.640 N/A
17 TRCN0000072201 GTCGAGCTGGACGGCGACGTA CONTROL -10 GFP pLKO.1 49 CDS 100% 100% 0.000 N/A
18 TRCN0000072202 GCCACAACATCGAGGACGGCA CONTROL -10 GFP pLKO.1 506 CDS 100% 100% 0.000 N/A
19 TRCN0000206973 GCACGACTTCTTCAAGTCCGC CONTROL -10 GFP pLKO.1 243 CDS 100% 100% 0.018 N/A
20 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC CONTROL -10 GFP pLKO.1 616 CDS 100% 100% 0.000 N/A
21 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC CONTROL -10 GFP pLKO.1 21 CDS 100% 100% 0.000 N/A
22 TRCN0000207065 GCGATCACATGGTCCTGCTGG CONTROL -10 GFP pLKO.1 647 CDS 100% 100% 0.000 N/A
23 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA CONTROL -10 GFP pLKO.1 668 CDS 100% 100% 0.000 N/A
24 TRCN0000231750 CAACAGCCACAACGTCTATAT CONTROL -10 GFP pLKO_TRC005 438 CDS 100% 100% 13.200 N/A
25 TRCN0000231749 CGACCACATGAAGCAGCACGA CONTROL -10 GFP pLKO_TRC005 228 CDS 100% 100% 0.720 N/A
26 TRCN0000231754 CTATATCATGGCCGACAAGCA CONTROL -10 GFP pLKO_TRC005 453 CDS 100% 100% 2.640 N/A
27 TRCN0000231752 TCTCGGCATGGACGAGCTGTA CONTROL -10 GFP pLKO_TRC005 693 CDS 100% 100% 1.350 N/A
28 TRCN0000231751 CGGCATGGACGAGCTGTACAA CONTROL -10 GFP pLKO_TRC005 696 CDS 100% 100% 1.650 N/A
29 TRCN0000231748 CGGGATCACTCTCGGCATGGA CONTROL -10 GFP pLKO_TRC005 684 CDS 100% 100% 0.000 N/A
30 TRCN0000231764 CTCTCGGCATGGACGAGCTGT CONTROL -10 GFP pLKO_TRC005 692 CDS 100% 100% 0.000 N/A
31 TRCN0000231763 CCCGACCACATGAAGCAGCAC CONTROL -10 GFP pLKO_TRC005 226 CDS 100% 100% 0.000 N/A
32 TRCN0000231759 GACCACATGAAGCAGCACGAC CONTROL -10 GFP pLKO_TRC005 229 CDS 100% 100% 0.720 N/A
33 TRCN0000231761 CGACGTAAACGGCCACAAGTT CONTROL -10 GFP pLKO_TRC005 63 CDS 100% 100% 4.950 N/A
34 TRCN0000231762 CCACATGAAGCAGCACGACTT CONTROL -10 GFP pLKO_TRC005 231 CDS 100% 100% 4.050 N/A
35 TRCN0000231755 GCGACGTAAACGGCCACAAGT CONTROL -10 GFP pLKO_TRC005 62 CDS 100% 100% 1.650 N/A
36 TRCN0000231756 ACGTCTATATCATGGCCGACA CONTROL -10 GFP pLKO_TRC005 449 CDS 100% 100% 2.160 N/A
37 TRCN0000231757 CTACGGCAAGCTGACCCTGAA CONTROL -10 GFP pLKO_TRC005 117 CDS 100% 100% 1.350 N/A
38 TRCN0000231758 GCGCGATCACATGGTCCTGCT CONTROL -10 GFP pLKO_TRC005 645 CDS 100% 100% 0.000 N/A
39 TRCN0000231745 TGACCCTGAAGTTCATCTGCA CONTROL -10 GFP pLKO_TRC005 128 CDS 100% 100% 2.640 N/A
40 TRCN0000231705 GCCACAACATCGAGGACGGCA CONTROL -10 GFP pLKO_TRC005 506 CDS 100% 100% 0.000 N/A
41 TRCN0000072181 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO.1 437 CDS 95% 94% N/A N/A
42 TRCN0000072185 TACAACAGCCACAACGTCTAT CONTROL -10 GFP pLKO.1 436 CDS 95% 94% N/A N/A
43 TRCN0000072186 TGCCCGACAACCACTACCTGA CONTROL -10 GFP pLKO.1 587 CDS 95% 94% N/A N/A
44 TRCN0000072192 GAACGGCATCAAGGTGAACTT CONTROL -10 GFP pLKO.1 477 CDS 95% 94% N/A N/A
45 TRCN0000072200 AGTACAACTACAACAGCCACA CONTROL -10 GFP pLKO.1 428 CDS 95% 94% N/A N/A
46 TRCN0000559395 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC022 437 CDS 95% 94% N/A N/A
47 TRCN0000559396 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC018 437 CDS 95% 94% N/A N/A
48 TRCN0000559397 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC016 437 CDS 95% 94% N/A N/A
49 TRCN0000559399 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC023 437 CDS 95% 94% N/A N/A
50 TRCN0000559393 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC024 437 CDS 95% 94% N/A N/A
51 TRCN0000559401 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC008 437 CDS 95% 94% N/A N/A
52 TRCN0000559394 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC047 437 CDS 95% 94% N/A N/A
53 TRCN0000559403 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC046 437 CDS 95% 94% N/A N/A
54 TRCN0000559407 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC017 437 CDS 95% 94% N/A N/A
55 TRCN0000559408 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC021 437 CDS 95% 94% N/A N/A
56 TRCN0000231753 ACAACAGCCACAACGTCTATA CONTROL -10 GFP pLKO_TRC005 437 CDS 95% 94% N/A N/A
57 TRCN0000231747 TACAACAGCCACAACGTCTAT CONTROL -10 GFP pLKO_TRC005 436 CDS 95% 94% N/A N/A
58 TRCN0000231746 TGCCCGACAACCACTACCTGA CONTROL -10 GFP pLKO_TRC005 587 CDS 95% 94% N/A N/A
59 TRCN0000231760 GAACGGCATCAAGGTGAACTT CONTROL -10 GFP pLKO_TRC005 477 CDS 95% 94% N/A N/A
60 TRCN0000231744 AGTACAACTACAACAGCCACA CONTROL -10 GFP pLKO_TRC005 428 CDS 95% 94% N/A N/A
61 TRCN0000207020 GACCACCCTGACCTACGGCGT CONTROL -10 GFP pLKO.1 186 CDS 90% 89% N/A N/A
62 TRCN0000267504 TTGACCCTGAGTTCATCTGAG human 246744 STH pLKO_TRC005 202 CDS 81% 90% N/A N/A
63 TRCN0000074878 GCCTACTACTACCAGCAGAAA human 84844 PHF5A pLKO.1 443 3UTR 85% 89% N/A N/A
64 TRCN0000286158 GCCTACTACTACCAGCAGAAA human 84844 PHF5A pLKO_TRC005 443 3UTR 85% 89% N/A N/A
65 TRCN0000254814 ACAAGCCTGGAATCAACTTCT human 245934 DEFB121 pLKO_TRC005 238 CDS 81% 85% N/A N/A
66 TRCN0000414038 GTGGCACAGCTGGAGTATAAA human 4898 NRD1 pLKO_TRC005 2759 CDS 81% 85% N/A N/A
67 TRCN0000038321 CCTGAAGTCATTGGACCACTT human 6554 SLC10A1 pLKO.1 908 CDS 78% 85% N/A N/A
68 TRCN0000063841 GAAGAAGGCATCAGGCGATAA human 27111 SDCBP2 pLKO.1 432 CDS 78% 85% N/A N/A
69 TRCN0000165696 CAGCCATTACTGACACCCAAA human 25921 ZDHHC5 pLKO.1 3219 CDS 78% 85% N/A N/A
70 TRCN0000033383 CCACAACACGAGGACGGAGAA human 7473 WNT3 pLKO.1 1073 CDS 77% 85% N/A N/A
71 TRCN0000045016 CATCGTGGTGAGCTGGATGAT human 293 SLC25A6 pLKO.1 719 CDS 77% 85% N/A N/A
72 TRCN0000064928 GCGCCTACAAATCGAGGACTT human 51079 NDUFA13 pLKO.1 634 CDS 77% 85% N/A N/A
73 TRCN0000116441 CCACAACATCGTGACGGCGCA human 7122 CLDN5 pLKO.1 581 CDS 77% 85% N/A N/A
74 TRCN0000145006 GACCCTGAAGTTATCTCTATA human 80133 C1orf129 pLKO.1 1610 CDS 77% 85% N/A N/A
75 TRCN0000418307 CCGAAGTGCTCGTCCAGTATT human 1302 COL11A2 pLKO_TRC005 756 CDS 77% 85% N/A N/A
76 TRCN0000022398 CAACGAGAACGCCACATGGTC human 55658 RNF126 pLKO.1 1015 CDS 84% 82% N/A N/A
77 TRCN0000243830 CATGCCCAAGGACATCCAGTT human 653604 HIST2H3D pLKO_TRC005 360 CDS 75% 81% N/A N/A
78 TRCN0000007231 GCATCACATCAGGAGGATGTT human 8837 CFLAR pLKO.1 1480 CDS 73% 80% N/A N/A
79 TRCN0000020555 GCCACACTTCAGCTGTCTGTA human 6689 SPIB pLKO.1 38 CDS 73% 80% N/A N/A
80 TRCN0000057866 CCATGAAGTATCTGGACCAAA human 6356 CCL11 pLKO.1 392 CDS 73% 80% N/A N/A
81 TRCN0000057952 CCATGAAGCATCTGGACCAAA human 6355 CCL8 pLKO.1 712 CDS 73% 80% N/A N/A
82 TRCN0000154355 CTTCAGAGGAAGAGCAACAAA human 391267 ANKRD20A11P pLKO.1 949 3UTR 73% 80% N/A N/A
83 TRCN0000199135 CACTGACCTGAACGCAGTCAT human 225689 MAPK15 pLKO.1 329 CDS 73% 80% N/A N/A
84 TRCN0000344522 CACTGACCTGAACGCAGTCAT human 225689 MAPK15 pLKO_TRC005 329 CDS 73% 80% N/A N/A
85 TRCN0000022396 GCAACGAGAACGCCACATGGT human 55658 RNF126 pLKO.1 1014 CDS 80% 78% N/A N/A
86 TRCN0000430217 TGGTGAAGCGCAAGTTGAAGG human 201191 SAMD14 pLKO_TRC005 1516 CDS 79% 77% N/A N/A
87 TRCN0000140016 GAGCAAGGAGAAGCTGTTGAT human 203062 TSNARE1 pLKO.1 1459 CDS 75% 77% N/A N/A
88 TRCN0000369225 AGAAGTACGTCAAGGAGAACC human 256302 C17orf103 pLKO_TRC005 289 CDS 75% 77% N/A N/A
89 TRCN0000159917 CAGCAAAGACAAAGAGAAGAA human 55257 C20orf20 pLKO.1 509 CDS 70% 77% N/A N/A
90 TRCN0000153179 GCAGTACAACAACAGCTACTT human 114794 ELFN2 pLKO.1 983 CDS 70% 77% N/A N/A
91 TRCN0000296724 CAACAACCTGGACAAGCTATG human 3976 LIF pLKO_TRC005 337 CDS 70% 77% N/A N/A
92 TRCN0000437190 GCTACGAGGAGTGCATCATAG human 3482 IGF2R pLKO_TRC005 5886 CDS 70% 77% N/A N/A
93 TRCN0000413906 ACGTCAAGTAGGACAACATAT human 23304 UBR2 pLKO_TRC005 1563 CDS 70% 77% N/A N/A
94 TRCN0000270653 TCAAGGAAGATGGCAACATTA mouse 574403 Fam196b pLKO_TRC005 805 CDS 80% 89% N/A N/A
95 TRCN0000375784 TCACGGACTACGGCAACTATG mouse 219249 Tdrd3 pLKO_TRC005 2273 CDS 80% 89% N/A N/A
96 TRCN0000024366 TCGAGTGAAGCTCATCGACTT mouse 545156 Kalrn pLKO.1 1240 CDS 86% 85% N/A N/A
97 TRCN0000328670 ATCATGGCCACAAACCGAATA mouse 19179 Psmc1 pLKO_TRC005 989 CDS 81% 85% N/A N/A
98 TRCN0000065844 GCTGGGAACAACTCAACAGAA mouse 18654 Pgf pLKO.1 401 CDS 78% 85% N/A N/A
99 TRCN0000120751 GACCTGAAGCACGACTTCAAT mouse 57444 Isg20 pLKO.1 518 CDS 79% 81% N/A N/A
100 TRCN0000241466 TACAACACACAACTCTATATA mouse 76719 1700081L11Rik pLKO_TRC005 1300 CDS 79% 81% N/A N/A
101 TRCN0000350156 GACCTGAAGCACGACTTCAAT mouse 57444 Isg20 pLKO_TRC005 571 CDS 79% 81% N/A N/A
102 TRCN0000092885 CATGCCCAAGGACATCCAGTT mouse 97114 Hist2h3c2 pLKO.1 546 CDS 75% 81% N/A N/A
103 TRCN0000351064 ACGAGCTGGAACACTTCAATG mouse 225849 Ppp2r5b pLKO_TRC005 1328 CDS 75% 81% N/A N/A
104 TRCN0000085075 CCTATGGCAACTATCCTGAAA mouse 14013 Mecom pLKO.1 71 CDS 78% 80% N/A N/A
105 TRCN0000100049 TCAGGGCCTCAAGAGAAGAAA mouse 27218 Slamf1 pLKO.1 951 CDS 78% 80% N/A N/A
106 TRCN0000249300 CTTCGACAGAACAAGTCTATT mouse 217366 Lrrc45 pLKO_TRC005 445 CDS 78% 80% N/A N/A
107 TRCN0000087391 GCTGCCGACAAGGACTACCAT mouse 50760 Fbxo17 pLKO.1 1073 CDS 73% 80% N/A N/A
108 TRCN0000089425 AGCACCTTCTTCTAGTCCCAA mouse 20256 Clec11a pLKO.1 410 CDS 73% 80% N/A N/A
109 TRCN0000193886 CCACAAGTATATACATGGTGA mouse 171197 Vmn1r23 pLKO.1 578 CDS 73% 80% N/A N/A
110 TRCN0000188882 GTGCTTATCCTTCGAGCTGTT mouse 258355 Olfr677 pLKO.1 658 CDS 73% 80% N/A N/A
111 TRCN0000176338 CATCGAGAAGAGAATCGACAA mouse 216049 Zfp365 pLKO.1 595 CDS 70% 77% N/A N/A
112 TRCN0000250610 CGGCATCAAGCTGCACAAGAA mouse 72500 Ier5l pLKO_TRC005 266 CDS 70% 77% N/A N/A
113 TRCN0000454647 TCAAGGACTTCATGATCCAAG mouse 68816 Ppil1 pLKO_TRC005 214 CDS 70% 77% N/A N/A
Download CSV

All hairpins matching current transcripts from this gene

(this is the union of the above two tables, provided here as a single download link)

Download CSV

ORFs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464762 CONTROL BFP.1 -40 BFP pDONR223 0% 99.5% 99.5% None 718_720delTTG
2 ccsbBroad301_99985 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.5% 99.5% None 718_720delTTG
3 ccsbBroad301_99986 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.5% 99.5% None 718_720delTTG
4 ccsbBroad301_99987 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.5% 99.5% None 718_720delTTG
5 ccsbBroad301_99980 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.5% 99.5% None 718_720delTTG
6 ccsbBroad304_99986 CONTROL BFP.1 -40 BFP pLX_TRC304 82.4% 99.5% 99.5% V5 718_720delTTG
7 BRDN0000464777 CONTROL BFP.1 -40 BFP pLX_TRC302 0% 99.5% 99.5% V5 718_720delTTG
8 ccsbBroad304_99985 CONTROL BFP.1 -40 BFP pLX_TRC304 72.2% 99.4% 99.1% V5 (not translated due to prior stop codon) 716A>N;718_720delTTG
9 ccsbBroad304_99987 CONTROL BFP.1 -40 BFP pLX_TRC304 88.7% 99.3% 25% V5 (not translated due to frame shift) 99delG;116delC;718_720delTTG
10 BRDN0000464763 CONTROL BFP.1 -40 BFP pDONR223 0% 99.5% 99.5% None 718_720delTTG
11 BRDN0000464764 CONTROL BFP.1 -40 BFP pDONR223 0% 99.5% 99.5% None 718_720delTTG
12 ccsbBroad301_99997 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 98.7% 97.9% None (many diffs)
13 ccsbBroad301_99998 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 98.7% 97.9% None (many diffs)
14 ccsbBroad301_99999 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 98.7% 97.9% None (many diffs)
15 ccsbBroad301_99984 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 98.7% 97.9% None (many diffs)
16 ccsbBroad304_99997 CONTROL BFP.1 -40 BFP pLX_TRC304 71.7% 98.7% 97.9% V5 (not translated due to frame shift) (many diffs)
17 ccsbBroad304_99998 CONTROL BFP.1 -40 BFP pLX_TRC304 71.7% 98.7% 97.9% V5 (not translated due to frame shift) (many diffs)
18 ccsbBroad304_99999 CONTROL BFP.1 -40 BFP pLX_TRC304 72.2% 98.7% 97.9% V5 (not translated due to frame shift) (many diffs)
19 BRDN0000559443 CONTROL BFP.1 -40 BFP pLX_TRC307 0% 98.7% 97.9% V5 (many diffs)
20 BRDN0000464774 CONTROL BFP.1 -40 BFP pDONR221 0% 98.7% 97.9% None (many diffs)
21 BRDN0000464781 CONTROL BFP.1 -40 BFP pLX_TRC302 0% 98.7% 97.9% V5 (many diffs)
22 BRDN0000556273 CONTROL BFP.1 -40 BFP pLX_TRC303 0% 98.7% 97.9% None (many diffs)
23 BRDN0000556285 CONTROL BFP.1 -40 BFP pLX_TRC305 0% 98.7% 97.9% None (many diffs)
24 BRDN0000556297 CONTROL BFP.1 -40 BFP pLX_TRC306 0% 98.7% 97.9% V5 (many diffs)
25 BRDN0000556276 CONTROL BFP.1 -40 BFP pLXI_TRC401 0% 98.7% 97.9% None (many diffs)
26 BRDN0000556271 CONTROL BFP.1 -40 BFP pLXI_TRC402 0% 98.7% 97.9% HA (many diffs)
27 BRDN0000556283 CONTROL BFP.1 -40 BFP pLX_TRC311 0% 98.7% 97.9% V5 (many diffs)
28 BRDN0000556281 CONTROL BFP.1 -40 BFP pLX_TRC313 0% 98.7% 97.9% V5 (many diffs)
29 BRDN0000556292 CONTROL BFP.1 -40 BFP pLX_TRC314 0% 98.7% 97.9% V5 (many diffs)
30 BRDN0000556298 CONTROL BFP.1 -40 BFP pLX_TRC315 0% 98.7% 97.9% V5 (many diffs)
31 BRDN0000556286 CONTROL BFP.1 -40 BFP pLXI_TRC403 0% 98.7% 97.9% V5 (many diffs)
32 BRDN0000464775 CONTROL BFP.1 -40 BFP pDONR221 0% 98.7% 97.9% None (many diffs)
33 BRDN0000464776 CONTROL BFP.1 -40 BFP pDONR221 0% 98.7% 97.9% None (many diffs)
Download CSV