Gene: eGFP (-44)

Hahn Lab eGFP

Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -44 (eGFP), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -44 (eGFP), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 ccsbBroad301_99984 CONTROL eGFP.1 -44 eGFP pLX_TRC301 0% 100% 100% None N/A
2 ccsbBroad301_99997 CONTROL eGFP.1 -44 eGFP pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99998 CONTROL eGFP.1 -44 eGFP pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99999 CONTROL eGFP.1 -44 eGFP pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad304_99997 CONTROL eGFP.1 -44 eGFP pLX_TRC304 71.7% 100% 100% V5 (not translated due to frame shift) N/A
6 ccsbBroad304_99998 CONTROL eGFP.1 -44 eGFP pLX_TRC304 71.7% 100% 100% V5 (not translated due to frame shift) N/A
7 ccsbBroad304_99999 CONTROL eGFP.1 -44 eGFP pLX_TRC304 72.2% 100% 100% V5 (not translated due to frame shift) N/A
8 BRDN0000559443 CONTROL eGFP.1 -44 eGFP pLX_TRC307 0% 100% 100% V5 N/A
9 BRDN0000464774 CONTROL eGFP.1 -44 eGFP pDONR221 0% 100% 100% None N/A
10 BRDN0000464781 CONTROL eGFP.1 -44 eGFP pLX_TRC302 0% 100% 100% V5 N/A
11 BRDN0000556273 CONTROL eGFP.1 -44 eGFP pLX_TRC303 0% 100% 100% None N/A
12 BRDN0000556285 CONTROL eGFP.1 -44 eGFP pLX_TRC305 0% 100% 100% None N/A
13 BRDN0000556297 CONTROL eGFP.1 -44 eGFP pLX_TRC306 0% 100% 100% V5 N/A
14 BRDN0000556276 CONTROL eGFP.1 -44 eGFP pLXI_TRC401 0% 100% 100% None N/A
15 BRDN0000556271 CONTROL eGFP.1 -44 eGFP pLXI_TRC402 0% 100% 100% HA N/A
16 BRDN0000556283 CONTROL eGFP.1 -44 eGFP pLX_TRC311 0% 100% 100% V5 N/A
17 BRDN0000556281 CONTROL eGFP.1 -44 eGFP pLX_TRC313 0% 100% 100% V5 N/A
18 BRDN0000556292 CONTROL eGFP.1 -44 eGFP pLX_TRC314 0% 100% 100% V5 N/A
19 BRDN0000556298 CONTROL eGFP.1 -44 eGFP pLX_TRC315 0% 100% 100% V5 N/A
20 BRDN0000556286 CONTROL eGFP.1 -44 eGFP pLXI_TRC403 0% 100% 100% V5 N/A
21 BRDN0000559466 CONTROL eGFP.1 -44 eGFP ATCGATTTTGTATTTGGAGGCCCT pLX_TRC317 70% 100% 100% V5 N/A
22 BRDN0000464775 CONTROL eGFP.1 -44 eGFP pDONR221 0% 100% 100% None N/A
23 BRDN0000464776 CONTROL eGFP.1 -44 eGFP pDONR221 0% 100% 100% None N/A
24 BRDN0000464762 CONTROL eGFP.1 -44 eGFP pDONR223 0% 99.1% 98.3% None (many diffs)
25 ccsbBroad301_99980 CONTROL eGFP.1 -44 eGFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
26 ccsbBroad301_99985 CONTROL eGFP.1 -44 eGFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
27 ccsbBroad301_99986 CONTROL eGFP.1 -44 eGFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
28 ccsbBroad301_99987 CONTROL eGFP.1 -44 eGFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
29 ccsbBroad304_99986 CONTROL eGFP.1 -44 eGFP pLX_TRC304 82.4% 99.1% 98.3% V5 (many diffs)
30 BRDN0000464777 CONTROL eGFP.1 -44 eGFP pLX_TRC302 0% 99.1% 98.3% V5 (many diffs)
31 BRDN0000559460 CONTROL eGFP.1 -44 eGFP TAGAGATTGGGTTCAACCTGGAAG pLX_TRC317 61.8% 99.1% 98.3% V5 (many diffs)
32 ccsbBroad304_99985 CONTROL eGFP.1 -44 eGFP pLX_TRC304 72.2% 99% 97.9% V5 (not translated due to prior stop codon) (many diffs)
33 ccsbBroad304_99987 CONTROL eGFP.1 -44 eGFP pLX_TRC304 88.7% 98.8% 23.5% V5 (not translated due to frame shift) (many diffs)
34 BRDN0000464763 CONTROL eGFP.1 -44 eGFP pDONR223 0% 99.1% 98.3% None (many diffs)
35 BRDN0000464764 CONTROL eGFP.1 -44 eGFP pDONR223 0% 99.1% 98.3% None (many diffs)
Download CSV