Gene: Luciferase (-43)


Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -43 (Luciferase), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072254 ATGTTTACTACACTCGGATAT pLKO.1 Luciferase.1 CDS 100% 10.800 N/A N/A LUCIFERASE
2 TRCN0000231737 ATGTTTACTACACTCGGATAT pLKO_TRC005 Luciferase.1 CDS 100% 10.800 N/A N/A LUCIFERASE
3 TRCN0000072258 TGTCCGGTTATGTAAACAATC pLKO.1 Luciferase.1 CDS 100% 10.800 N/A N/A LUCIFERASE
4 TRCN0000231721 TGTCCGGTTATGTAAACAATC pLKO_TRC005 Luciferase.1 CDS 100% 10.800 N/A N/A LUCIFERASE
5 TRCN0000072253 ACACTCGGATATTTGATATGT pLKO.1 Luciferase.1 CDS 100% 5.625 N/A N/A LUCIFERASE
7 TRCN0000072256 ACGCTGAGTACTTCGAAATGT pLKO.1 Luciferase.1 CDS 100% 5.625 N/A N/A LUCIFERASE
9 TRCN0000072250 AGAATCGTCGTATGCAGTGAA pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
10 TRCN0000231730 AGAATCGTCGTATGCAGTGAA pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
11 TRCN0000072246 CAAATCACAGAATCGTCGTAT pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
12 TRCN0000231699 CAAATCACAGAATCGTCGTAT pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
13 TRCN0000072261 CACTCGGATATTTGATATGTG pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
14 TRCN0000231707 CACTCGGATATTTGATATGTG pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
15 TRCN0000072259 CGCTGAGTACTTCGAAATGTC pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
16 TRCN0000231715 CGCTGAGTACTTCGAAATGTC pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
17 TRCN0000072247 GAATCGTCGTATGCAGTGAAA pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
18 TRCN0000231720 GAATCGTCGTATGCAGTGAAA pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
19 TRCN0000072265 GTTGTGTTTGTGGACGAAGTA pLKO.1 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
20 TRCN0000231727 GTTGTGTTTGTGGACGAAGTA pLKO_TRC005 Luciferase.1 CDS 100% 4.950 N/A N/A LUCIFERASE
21 TRCN0000072248 AGTCAAGTAACAACCGCGAAA pLKO.1 Luciferase.1 CDS 100% 4.050 N/A N/A LUCIFERASE
22 TRCN0000231718 AGTCAAGTAACAACCGCGAAA pLKO_TRC005 Luciferase.1 CDS 100% 4.050 N/A N/A LUCIFERASE
23 TRCN0000072252 ACTTACGCTGAGTACTTCGAA pLKO.1 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
24 TRCN0000231733 ACTTACGCTGAGTACTTCGAA pLKO_TRC005 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
25 TRCN0000072244 ATCACAGAATCGTCGTATGCA pLKO.1 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
26 TRCN0000231695 ATCACAGAATCGTCGTATGCA pLKO_TRC005 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
27 TRCN0000072255 TCTACTGGTCTGCCTAAAGGT pLKO.1 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
28 TRCN0000231734 TCTACTGGTCTGCCTAAAGGT pLKO_TRC005 Luciferase.1 CDS 100% 3.000 N/A N/A LUCIFERASE
29 TRCN0000072262 CACTTACGCTGAGTACTTCGA pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
30 TRCN0000231736 CACTTACGCTGAGTACTTCGA pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
31 TRCN0000072260 CAGAATCGTCGTATGCAGTGA pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
32 TRCN0000231714 CAGAATCGTCGTATGCAGTGA pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
33 TRCN0000072243 CTTCGAAATGTCCGTTCGGTT pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
34 TRCN0000231693 CTTCGAAATGTCCGTTCGGTT pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
35 TRCN0000072266 GAATGTTTACTACACTCGGAT pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
36 TRCN0000231729 GAATGTTTACTACACTCGGAT pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
37 TRCN0000072251 GAGTACTTCGAAATGTCCGTT pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
38 TRCN0000231728 GAGTACTTCGAAATGTCCGTT pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
39 TRCN0000072264 GCTGAGTACTTCGAAATGTCC pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
40 TRCN0000231741 GCTGAGTACTTCGAAATGTCC pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
41 TRCN0000072245 TCACAGAATCGTCGTATGCAG pLKO.1 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
42 TRCN0000231697 TCACAGAATCGTCGTATGCAG pLKO_TRC005 Luciferase.1 CDS 100% 2.640 N/A N/A LUCIFERASE
43 TRCN0000072263 AGTACTTCGAAATGTCCGTTC pLKO.1 Luciferase.1 CDS 100% 2.250 N/A N/A LUCIFERASE
44 TRCN0000231739 AGTACTTCGAAATGTCCGTTC pLKO_TRC005 Luciferase.1 CDS 100% 2.250 N/A N/A LUCIFERASE
45 TRCN0000072249 GCGGTTGCCAAGAGGTTCCAT pLKO.1 Luciferase.1 CDS 100% 1.000 N/A N/A LUCIFERASE
46 TRCN0000231719 GCGGTTGCCAAGAGGTTCCAT pLKO_TRC005 Luciferase.1 CDS 100% 1.000 N/A N/A LUCIFERASE
47 TRCN0000072267 GCGCCATTCTATCCGCTGGAA pLKO.1 Luciferase.1 CDS 100% 0.880 N/A N/A LUCIFERASE
48 TRCN0000231731 GCGCCATTCTATCCGCTGGAA pLKO_TRC005 Luciferase.1 CDS 100% 0.880 N/A N/A LUCIFERASE
49 TRCN0000072257 TGAGTACTTCGAAATGTCCGT pLKO.1 Luciferase.1 CDS 100% 0.660 N/A N/A LUCIFERASE
50 TRCN0000231740 TGAGTACTTCGAAATGTCCGT pLKO_TRC005 Luciferase.1 CDS 100% 0.660 N/A N/A LUCIFERASE
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -43 (Luciferase), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464768 CONTROL Luciferase.1 -43 Luciferase pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99992 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99993 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99991 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99982 CONTROL Luciferase.1 -43 Luciferase pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99991 CONTROL Luciferase.1 -43 Luciferase pLX_TRC304 18.9% 100% 100% V5 N/A
7 ccsbBroad304_99992 CONTROL Luciferase.1 -43 Luciferase pLX_TRC304 18.9% 100% 100% V5 N/A
8 BRDN0000559440 CONTROL Luciferase.1 -43 Luciferase pLX_TRC307 0% 100% 100% V5 N/A
9 BRDN0000464779 CONTROL Luciferase.1 -43 Luciferase pLX_TRC302 0% 100% 100% V5 N/A
10 BRDN0000556282 CONTROL Luciferase.1 -43 Luciferase pLX_TRC303 0% 100% 100% None N/A
11 BRDN0000556262 CONTROL Luciferase.1 -43 Luciferase pLX_TRC305 0% 100% 100% None N/A
12 BRDN0000556299 CONTROL Luciferase.1 -43 Luciferase pLX_TRC306 0% 100% 100% V5 N/A
13 BRDN0000556280 CONTROL Luciferase.1 -43 Luciferase pLXI_TRC401 0% 100% 100% None N/A
14 BRDN0000556275 CONTROL Luciferase.1 -43 Luciferase pLXI_TRC402 0% 100% 100% HA N/A
15 BRDN0000556301 CONTROL Luciferase.1 -43 Luciferase pLX_TRC311 0% 100% 100% V5 N/A
16 BRDN0000556296 CONTROL Luciferase.1 -43 Luciferase pLX_TRC312 0% 100% 100% V5 N/A
17 BRDN0000556302 CONTROL Luciferase.1 -43 Luciferase pLX_TRC313 0% 100% 100% V5 N/A
18 BRDN0000556293 CONTROL Luciferase.1 -43 Luciferase pLX_TRC314 0% 100% 100% V5 N/A
19 BRDN0000556270 CONTROL Luciferase.1 -43 Luciferase pLX_TRC315 0% 100% 100% V5 N/A
20 BRDN0000556289 CONTROL Luciferase.1 -43 Luciferase pLXI_TRC403 0% 100% 100% V5 N/A
21 ccsbBroad304_99993 CONTROL Luciferase.1 -43 Luciferase pLX_TRC304 44.2% 76.8% 56.5% V5 (not translated due to prior stop codon) (many diffs)
22 BRDN0000464769 CONTROL Luciferase.1 -43 Luciferase pDONR223 0% 100% 100% None N/A
23 BRDN0000464770 CONTROL Luciferase.1 -43 Luciferase pDONR223 0% 100% 100% None N/A
Download CSV