Gene: LacZ (-42)

Hahn Lab LacZ

Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -42 (LacZ), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072236 CCAACGTGACCTATCCCATTA pLKO.1 LacZ.1 CDS 100% 10.800 N/A N/A lacZ
2 TRCN0000231735 CCAACGTGACCTATCCCATTA pLKO_TRC005 LacZ.1 CDS 100% 10.800 N/A N/A lacZ
3 TRCN0000072242 GTCGGCTTACGGCGGTGATTT pLKO.1 LacZ.1 CDS 100% 4.400 N/A N/A lacZ
4 TRCN0000231706 GTCGGCTTACGGCGGTGATTT pLKO_TRC005 LacZ.1 CDS 100% 4.400 N/A N/A lacZ
5 TRCN0000072238 GTTCCGTCATAGCGATAACGA pLKO.1 LacZ.1 CDS 100% 3.000 N/A N/A lacZ
6 TRCN0000231685 GTTCCGTCATAGCGATAACGA pLKO_TRC005 LacZ.1 CDS 100% 3.000 N/A N/A lacZ
7 TRCN0000072226 CGATCGTAATCACCCGAGTGT pLKO.1 LacZ.1 CDS 100% 2.640 N/A N/A lacZ
8 TRCN0000231709 CGATCGTAATCACCCGAGTGT pLKO_TRC005 LacZ.1 CDS 100% 2.640 N/A N/A lacZ
9 TRCN0000072231 CGCTAAATACTGGCAGGCGTT pLKO.1 LacZ.1 CDS 100% 2.160 N/A N/A lacZ
10 TRCN0000231710 CGCTAAATACTGGCAGGCGTT pLKO_TRC005 LacZ.1 CDS 100% 2.160 N/A N/A lacZ
11 TRCN0000072229 GCGATCGTAATCACCCGAGTG pLKO.1 LacZ.1 CDS 100% 0.750 N/A N/A lacZ
12 TRCN0000231712 GCGATCGTAATCACCCGAGTG pLKO_TRC005 LacZ.1 CDS 100% 0.750 N/A N/A lacZ
13 TRCN0000072224 CGCGATCGTAATCACCCGAGT pLKO.1 LacZ.1 CDS 100% 0.720 N/A N/A lacZ
14 TRCN0000231722 CGCGATCGTAATCACCCGAGT pLKO_TRC005 LacZ.1 CDS 100% 0.720 N/A N/A lacZ
15 TRCN0000072241 GCGTTGGCAATTTAACCGCCA pLKO.1 LacZ.1 CDS 100% 0.540 N/A N/A lacZ
16 TRCN0000231704 GCGTTGGCAATTTAACCGCCA pLKO_TRC005 LacZ.1 CDS 100% 0.540 N/A N/A lacZ
17 TRCN0000072223 TGTTCGCATTATCCGAACCAT pLKO.1 LacZ.1 CDS 100% 0.300 N/A N/A lacZ
18 TRCN0000231726 TGTTCGCATTATCCGAACCAT pLKO_TRC005 LacZ.1 CDS 100% 0.300 N/A N/A lacZ
19 TRCN0000072230 CCCGTCAGTATCGGCGGAATT pLKO.1 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
20 TRCN0000231711 CCCGTCAGTATCGGCGGAATT pLKO_TRC005 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
21 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT pLKO.1 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
22 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT pLKO_TRC005 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
23 TRCN0000072227 GCGCTAATCACGACGCGCTGT pLKO.1 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
24 TRCN0000231708 GCGCTAATCACGACGCGCTGT pLKO_TRC005 LacZ.1 CDS 100% 0.000 N/A N/A lacZ
25 TRCN0000072235 CCGTCATAGCGATAACGAGTT pLKO.1 LacZ.1 CDS 100% 4.050 N/A N/A lacZ
26 TRCN0000231738 CCGTCATAGCGATAACGAGTT pLKO_TRC005 LacZ.1 CDS 100% 4.050 N/A N/A lacZ
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -42 (LacZ), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464771 CONTROL LacZ.1 -42 LacZ pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99994 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99995 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99996 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99983 CONTROL LacZ.1 -42 LacZ pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99994 CONTROL LacZ.1 -42 LacZ pLX_TRC304 3.4% 100% 100% V5 N/A
7 ccsbBroad304_99996 CONTROL LacZ.1 -42 LacZ pLX_TRC304 3.4% 100% 100% V5 N/A
8 ccsbBroad304_99995 CONTROL LacZ.1 -42 LacZ pLX_TRC304 3.4% 100% 100% V5 N/A
9 BRDN0000559441 CONTROL LacZ.1 -42 LacZ pLX_TRC307 0% 100% 100% V5 N/A
10 BRDN0000464780 CONTROL LacZ.1 -42 LacZ pLX_TRC302 0% 100% 100% V5 N/A
11 BRDN0000556272 CONTROL LacZ.1 -42 LacZ pLX_TRC303 0% 100% 100% None N/A
12 BRDN0000556278 CONTROL LacZ.1 -42 LacZ pLX_TRC305 0% 100% 100% None N/A
13 BRDN0000556288 CONTROL LacZ.1 -42 LacZ pLX_TRC306 0% 100% 100% V5 N/A
14 BRDN0000556266 CONTROL LacZ.1 -42 LacZ pLXI_TRC401 0% 100% 100% None N/A
15 BRDN0000556290 CONTROL LacZ.1 -42 LacZ pLXI_TRC402 0% 100% 100% HA N/A
16 BRDN0000556291 CONTROL LacZ.1 -42 LacZ pLX_TRC311 0% 100% 100% V5 N/A
17 BRDN0000556274 CONTROL LacZ.1 -42 LacZ pLX_TRC312 0% 100% 100% V5 N/A
18 BRDN0000556300 CONTROL LacZ.1 -42 LacZ pLX_TRC313 0% 100% 100% V5 N/A
19 BRDN0000556279 CONTROL LacZ.1 -42 LacZ pLX_TRC314 0% 100% 100% V5 N/A
20 BRDN0000556294 CONTROL LacZ.1 -42 LacZ pLX_TRC315 0% 100% 100% V5 N/A
21 BRDN0000556277 CONTROL LacZ.1 -42 LacZ pLXI_TRC403 0% 100% 100% V5 N/A
22 BRDN0000464772 CONTROL LacZ.1 -42 LacZ pDONR223 0% 100% 100% None N/A
23 BRDN0000464773 CONTROL LacZ.1 -42 LacZ pDONR223 0% 100% 100% None N/A
Download CSV