Gene: HcRed (-41)

Hahn Lab HcRed

Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -41 (HcRed), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

No results found.

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -41 (HcRed), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 BRDN0000464765 CONTROL HcRed.1 -41 HcRed pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99989 CONTROL HcRed.1 -41 HcRed pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99990 CONTROL HcRed.1 -41 HcRed pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99988 CONTROL HcRed.1 -41 HcRed pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99981 CONTROL HcRed.1 -41 HcRed pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99990 CONTROL HcRed.1 -41 HcRed pLX_TRC304 75.8% 100% 100% V5 N/A
7 BRDN0000559442 CONTROL HcRed.1 -41 HcRed pLX_TRC307 0% 100% 100% V5 N/A
8 BRDN0000464778 CONTROL HcRed.1 -41 HcRed pLX_TRC302 0% 100% 100% V5 N/A
9 BRDN0000556267 CONTROL HcRed.1 -41 HcRed pLX_TRC303 0% 100% 100% None N/A
10 BRDN0000556265 CONTROL HcRed.1 -41 HcRed pLX_TRC305 0% 100% 100% None N/A
11 BRDN0000556269 CONTROL HcRed.1 -41 HcRed pLX_TRC306 0% 100% 100% V5 N/A
12 BRDN0000556261 CONTROL HcRed.1 -41 HcRed pLXI_TRC401 0% 100% 100% None N/A
13 BRDN0000556287 CONTROL HcRed.1 -41 HcRed pLXI_TRC402 0% 100% 100% HA N/A
14 BRDN0000556264 CONTROL HcRed.1 -41 HcRed pLX_TRC311 0% 100% 100% V5 N/A
15 BRDN0000556295 CONTROL HcRed.1 -41 HcRed pLX_TRC312 0% 100% 100% V5 N/A
16 BRDN0000556268 CONTROL HcRed.1 -41 HcRed pLX_TRC313 0% 100% 100% V5 N/A
17 BRDN0000556263 CONTROL HcRed.1 -41 HcRed pLX_TRC314 0% 100% 100% V5 N/A
18 BRDN0000556284 CONTROL HcRed.1 -41 HcRed pLX_TRC315 0% 100% 100% V5 N/A
19 BRDN0000556260 CONTROL HcRed.1 -41 HcRed pLXI_TRC403 0% 100% 100% V5 N/A
20 BRDN0000559463 CONTROL HcRed.1 -41 HcRed TGCTATCACCACCGTACAGGTCCC pLX_TRC317 72.2% 100% 100% V5 N/A
21 ccsbBroad304_99988 CONTROL HcRed.1 -41 HcRed pLX_TRC304 76.9% 70.1% 41.2% V5 (not translated due to prior stop codon) (many diffs)
22 BRDN0000464766 CONTROL HcRed.1 -41 HcRed pDONR223 0% 100% 100% None N/A
23 BRDN0000464767 CONTROL HcRed.1 -41 HcRed pDONR223 0% 100% 100% None N/A
Download CSV