Gene: BFP (-40)

BFP

Taxon:
Control
Chromosome:
n/a
Wildtype Transcripts:
BFP.1

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -40 (BFP), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072178 CAACAGCCACAACGTCTATAT pLKO.1 BFP.1 CDS 100% 13.200 N/A N/A GFP
2 TRCN0000231750 CAACAGCCACAACGTCTATAT pLKO_TRC005 BFP.1 CDS 100% 13.200 N/A N/A GFP
3 TRCN0000072193 CGACGTAAACGGCCACAAGTT pLKO.1 BFP.1 CDS 100% 4.950 N/A N/A GFP
4 TRCN0000231761 CGACGTAAACGGCCACAAGTT pLKO_TRC005 BFP.1 CDS 100% 4.950 N/A N/A GFP
5 TRCN0000072194 CCACATGAAGCAGCACGACTT pLKO.1 BFP.1 CDS 100% 4.050 N/A N/A GFP
6 TRCN0000231762 CCACATGAAGCAGCACGACTT pLKO_TRC005 BFP.1 CDS 100% 4.050 N/A N/A GFP
7 TRCN0000072180 CTATATCATGGCCGACAAGCA pLKO.1 BFP.1 CDS 100% 2.640 N/A N/A GFP
8 TRCN0000231754 CTATATCATGGCCGACAAGCA pLKO_TRC005 BFP.1 CDS 100% 2.640 N/A N/A GFP
9 TRCN0000072199 TGACCCTGAAGTTCATCTGCA pLKO.1 BFP.1 CDS 100% 2.640 N/A N/A GFP
10 TRCN0000231745 TGACCCTGAAGTTCATCTGCA pLKO_TRC005 BFP.1 CDS 100% 2.640 N/A N/A GFP
11 TRCN0000072196 ACGTCTATATCATGGCCGACA pLKO.1 BFP.1 CDS 100% 2.160 N/A N/A GFP
12 TRCN0000231756 ACGTCTATATCATGGCCGACA pLKO_TRC005 BFP.1 CDS 100% 2.160 N/A N/A GFP
13 TRCN0000072183 CGGCATGGACGAGCTGTACAA pLKO.1 BFP.1 CDS 100% 1.650 N/A N/A GFP
14 TRCN0000231751 CGGCATGGACGAGCTGTACAA pLKO_TRC005 BFP.1 CDS 100% 1.650 N/A N/A GFP
15 TRCN0000072195 GCGACGTAAACGGCCACAAGT pLKO.1 BFP.1 CDS 100% 1.650 N/A N/A GFP
16 TRCN0000231755 GCGACGTAAACGGCCACAAGT pLKO_TRC005 BFP.1 CDS 100% 1.650 N/A N/A GFP
17 TRCN0000072197 CTACGGCAAGCTGACCCTGAA pLKO.1 BFP.1 CDS 100% 1.350 N/A N/A GFP
18 TRCN0000231757 CTACGGCAAGCTGACCCTGAA pLKO_TRC005 BFP.1 CDS 100% 1.350 N/A N/A GFP
19 TRCN0000072182 TCTCGGCATGGACGAGCTGTA pLKO.1 BFP.1 CDS 100% 1.350 N/A N/A GFP
20 TRCN0000231752 TCTCGGCATGGACGAGCTGTA pLKO_TRC005 BFP.1 CDS 100% 1.350 N/A N/A GFP
21 TRCN0000072179 CGACCACATGAAGCAGCACGA pLKO.1 BFP.1 CDS 100% 0.720 N/A N/A GFP
22 TRCN0000231749 CGACCACATGAAGCAGCACGA pLKO_TRC005 BFP.1 CDS 100% 0.720 N/A N/A GFP
23 TRCN0000072190 GACCACATGAAGCAGCACGAC pLKO.1 BFP.1 CDS 100% 0.720 N/A N/A GFP
24 TRCN0000231759 GACCACATGAAGCAGCACGAC pLKO_TRC005 BFP.1 CDS 100% 0.720 N/A N/A GFP
25 TRCN0000206973 GCACGACTTCTTCAAGTCCGC pLKO.1 BFP.1 CDS 100% 0.018 N/A N/A GFP
26 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
27 TRCN0000072188 CCCGACCACATGAAGCAGCAC pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
28 TRCN0000231763 CCCGACCACATGAAGCAGCAC pLKO_TRC005 BFP.1 CDS 100% 0.000 N/A N/A GFP
29 TRCN0000072184 CGGGATCACTCTCGGCATGGA pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
30 TRCN0000231748 CGGGATCACTCTCGGCATGGA pLKO_TRC005 BFP.1 CDS 100% 0.000 N/A N/A GFP
31 TRCN0000072187 CTCTCGGCATGGACGAGCTGT pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
32 TRCN0000231764 CTCTCGGCATGGACGAGCTGT pLKO_TRC005 BFP.1 CDS 100% 0.000 N/A N/A GFP
33 TRCN0000072202 GCCACAACATCGAGGACGGCA pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
34 TRCN0000231705 GCCACAACATCGAGGACGGCA pLKO_TRC005 BFP.1 CDS 100% 0.000 N/A N/A GFP
35 TRCN0000207065 GCGATCACATGGTCCTGCTGG pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
36 TRCN0000072198 GCGCGATCACATGGTCCTGCT pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
37 TRCN0000231758 GCGCGATCACATGGTCCTGCT pLKO_TRC005 BFP.1 CDS 100% 0.000 N/A N/A GFP
38 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
39 TRCN0000072201 GTCGAGCTGGACGGCGACGTA pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
40 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC pLKO.1 BFP.1 CDS 100% 0.000 N/A N/A GFP
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -40 (BFP), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

shRNA constructs originally designed to target this gene, but which may no longer match it

No results found.

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464762 CONTROL BFP.1 -40 BFP pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99985 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99986 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99987 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99980 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99986 CONTROL BFP.1 -40 BFP pLX_TRC304 82.4% 100% 100% V5 N/A
7 BRDN0000464777 CONTROL BFP.1 -40 BFP pLX_TRC302 0% 100% 100% V5 N/A
8 ccsbBroad304_99985 CONTROL BFP.1 -40 BFP pLX_TRC304 72.2% 99.8% 99.5% V5 (not translated due to prior stop codon) 716A>N
9 ccsbBroad304_99987 CONTROL BFP.1 -40 BFP pLX_TRC304 88.7% 99.7% 23.8% V5 (not translated due to frame shift) 99delG;116delC
10 BRDN0000464763 CONTROL BFP.1 -40 BFP pDONR223 0% 100% 100% None N/A
11 BRDN0000464764 CONTROL BFP.1 -40 BFP pDONR223 0% 100% 100% None N/A
12 ccsbBroad301_99997 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
13 ccsbBroad301_99998 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
14 ccsbBroad301_99999 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
15 ccsbBroad301_99984 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
16 ccsbBroad304_99997 CONTROL BFP.1 -40 BFP pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
17 ccsbBroad304_99998 CONTROL BFP.1 -40 BFP pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
18 ccsbBroad304_99999 CONTROL BFP.1 -40 BFP pLX_TRC304 72.2% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
19 BRDN0000559443 CONTROL BFP.1 -40 BFP pLX_TRC307 0% 99.1% 98.3% V5 (many diffs)
20 BRDN0000464774 CONTROL BFP.1 -40 BFP pDONR221 0% 99.1% 98.3% None (many diffs)
21 BRDN0000464781 CONTROL BFP.1 -40 BFP pLX_TRC302 0% 99.1% 98.3% V5 (many diffs)
22 BRDN0000556273 CONTROL BFP.1 -40 BFP pLX_TRC303 0% 99.1% 98.3% None (many diffs)
23 BRDN0000556285 CONTROL BFP.1 -40 BFP pLX_TRC305 0% 99.1% 98.3% None (many diffs)
24 BRDN0000556297 CONTROL BFP.1 -40 BFP pLX_TRC306 0% 99.1% 98.3% V5 (many diffs)
25 BRDN0000556276 CONTROL BFP.1 -40 BFP pLXI_TRC401 0% 99.1% 98.3% None (many diffs)
26 BRDN0000556271 CONTROL BFP.1 -40 BFP pLXI_TRC402 0% 99.1% 98.3% HA (many diffs)
27 BRDN0000556283 CONTROL BFP.1 -40 BFP pLX_TRC311 0% 99.1% 98.3% V5 (many diffs)
28 BRDN0000556281 CONTROL BFP.1 -40 BFP pLX_TRC313 0% 99.1% 98.3% V5 (many diffs)
29 BRDN0000556292 CONTROL BFP.1 -40 BFP pLX_TRC314 0% 99.1% 98.3% V5 (many diffs)
30 BRDN0000556298 CONTROL BFP.1 -40 BFP pLX_TRC315 0% 99.1% 98.3% V5 (many diffs)
31 BRDN0000556286 CONTROL BFP.1 -40 BFP pLXI_TRC403 0% 99.1% 98.3% V5 (many diffs)
32 BRDN0000464775 CONTROL BFP.1 -40 BFP pDONR221 0% 99.1% 98.3% None (many diffs)
33 BRDN0000464776 CONTROL BFP.1 -40 BFP pDONR221 0% 99.1% 98.3% None (many diffs)
Download CSV