Gene: BFP (-40)

Hahn Lab BFP

Wildtype Transcripts:

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -40 (BFP), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -40 (BFP), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 BRDN0000464762 CONTROL BFP.1 -40 BFP pDONR223 0% 100% 100% None N/A
2 ccsbBroad301_99986 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 100% 100% None N/A
3 ccsbBroad301_99987 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 100% 100% None N/A
4 ccsbBroad301_99985 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 100% 100% None N/A
5 ccsbBroad301_99980 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 100% 100% None N/A
6 ccsbBroad304_99986 CONTROL BFP.1 -40 BFP pLX_TRC304 82.4% 100% 100% V5 N/A
7 BRDN0000464777 CONTROL BFP.1 -40 BFP pLX_TRC302 0% 100% 100% V5 N/A
9 ccsbBroad304_99985 CONTROL BFP.1 -40 BFP pLX_TRC304 72.2% 99.8% 99.5% V5 (not translated due to prior stop codon) 716A>N
10 ccsbBroad304_99987 CONTROL BFP.1 -40 BFP pLX_TRC304 88.7% 99.7% 23.8% V5 (not translated due to frame shift) 99delG;116delC
11 BRDN0000464763 CONTROL BFP.1 -40 BFP pDONR223 0% 100% 100% None N/A
12 BRDN0000464764 CONTROL BFP.1 -40 BFP pDONR223 0% 100% 100% None N/A
13 ccsbBroad301_99997 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
14 ccsbBroad301_99998 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
15 ccsbBroad301_99999 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
16 ccsbBroad301_99984 CONTROL BFP.1 -40 BFP pLX_TRC301 0% 99.1% 98.3% None (many diffs)
17 ccsbBroad304_99997 CONTROL BFP.1 -40 BFP pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
18 ccsbBroad304_99998 CONTROL BFP.1 -40 BFP pLX_TRC304 71.7% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
19 ccsbBroad304_99999 CONTROL BFP.1 -40 BFP pLX_TRC304 72.2% 99.1% 98.3% V5 (not translated due to frame shift) (many diffs)
20 BRDN0000559443 CONTROL BFP.1 -40 BFP pLX_TRC307 0% 99.1% 98.3% V5 (many diffs)
21 BRDN0000464774 CONTROL BFP.1 -40 BFP pDONR221 0% 99.1% 98.3% None (many diffs)
22 BRDN0000464781 CONTROL BFP.1 -40 BFP pLX_TRC302 0% 99.1% 98.3% V5 (many diffs)
23 BRDN0000556273 CONTROL BFP.1 -40 BFP pLX_TRC303 0% 99.1% 98.3% None (many diffs)
24 BRDN0000556285 CONTROL BFP.1 -40 BFP pLX_TRC305 0% 99.1% 98.3% None (many diffs)
25 BRDN0000556297 CONTROL BFP.1 -40 BFP pLX_TRC306 0% 99.1% 98.3% V5 (many diffs)
26 BRDN0000556276 CONTROL BFP.1 -40 BFP pLXI_TRC401 0% 99.1% 98.3% None (many diffs)
27 BRDN0000556271 CONTROL BFP.1 -40 BFP pLXI_TRC402 0% 99.1% 98.3% HA (many diffs)
28 BRDN0000556283 CONTROL BFP.1 -40 BFP pLX_TRC311 0% 99.1% 98.3% V5 (many diffs)
29 BRDN0000556281 CONTROL BFP.1 -40 BFP pLX_TRC313 0% 99.1% 98.3% V5 (many diffs)
30 BRDN0000556292 CONTROL BFP.1 -40 BFP pLX_TRC314 0% 99.1% 98.3% V5 (many diffs)
31 BRDN0000556298 CONTROL BFP.1 -40 BFP pLX_TRC315 0% 99.1% 98.3% V5 (many diffs)
32 BRDN0000556286 CONTROL BFP.1 -40 BFP pLXI_TRC403 0% 99.1% 98.3% V5 (many diffs)
33 BRDN0000559466 CONTROL BFP.1 -40 BFP ATCGATTTTGTATTTGGAGGCCCT pLX_TRC317 70% 99.1% 98.3% V5 (many diffs)
34 BRDN0000464775 CONTROL BFP.1 -40 BFP pDONR221 0% 99.1% 98.3% None (many diffs)
35 BRDN0000464776 CONTROL BFP.1 -40 BFP pDONR221 0% 99.1% 98.3% None (many diffs)
Download CSV