Gene: lacZ (-15)

lacZ

Taxon:
Control
Chromosome:
n/a
Wildtype Transcripts:
lacZ.1

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -15 (lacZ), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072236 CCAACGTGACCTATCCCATTA pLKO.1 lacZ.1 CDS 100% 10.800 N/A N/A lacZ
2 TRCN0000231735 CCAACGTGACCTATCCCATTA pLKO_TRC005 lacZ.1 CDS 100% 10.800 N/A N/A lacZ
3 TRCN0000072242 GTCGGCTTACGGCGGTGATTT pLKO.1 lacZ.1 CDS 100% 4.400 N/A N/A lacZ
4 TRCN0000231706 GTCGGCTTACGGCGGTGATTT pLKO_TRC005 lacZ.1 CDS 100% 4.400 N/A N/A lacZ
5 TRCN0000072235 CCGTCATAGCGATAACGAGTT pLKO.1 lacZ.1 CDS 100% 4.050 N/A N/A lacZ
6 TRCN0000231738 CCGTCATAGCGATAACGAGTT pLKO_TRC005 lacZ.1 CDS 100% 4.050 N/A N/A lacZ
7 TRCN0000072233 CGACCACGCAAATCAGCGATT pLKO.1 lacZ.1 CDS 100% 4.050 N/A N/A lacZ
8 TRCN0000231716 CGACCACGCAAATCAGCGATT pLKO_TRC005 lacZ.1 CDS 100% 4.050 N/A N/A lacZ
9 TRCN0000072238 GTTCCGTCATAGCGATAACGA pLKO.1 lacZ.1 CDS 100% 3.000 N/A N/A lacZ
10 TRCN0000231685 GTTCCGTCATAGCGATAACGA pLKO_TRC005 lacZ.1 CDS 100% 3.000 N/A N/A lacZ
11 TRCN0000072226 CGATCGTAATCACCCGAGTGT pLKO.1 lacZ.1 CDS 100% 2.640 N/A N/A lacZ
12 TRCN0000231709 CGATCGTAATCACCCGAGTGT pLKO_TRC005 lacZ.1 CDS 100% 2.640 N/A N/A lacZ
13 TRCN0000072232 CGTCGTATTACAACGTCGTGA pLKO.1 lacZ.1 CDS 100% 2.640 N/A N/A lacZ
14 TRCN0000231717 CGTCGTATTACAACGTCGTGA pLKO_TRC005 lacZ.1 CDS 100% 2.640 N/A N/A lacZ
15 TRCN0000072240 TCGTATTACAACGTCGTGACT pLKO.1 lacZ.1 CDS 100% 2.640 N/A N/A lacZ
16 TRCN0000231702 TCGTATTACAACGTCGTGACT pLKO_TRC005 lacZ.1 CDS 100% 2.640 N/A N/A lacZ
17 TRCN0000072231 CGCTAAATACTGGCAGGCGTT pLKO.1 lacZ.1 CDS 100% 2.160 N/A N/A lacZ
18 TRCN0000231710 CGCTAAATACTGGCAGGCGTT pLKO_TRC005 lacZ.1 CDS 100% 2.160 N/A N/A lacZ
19 TRCN0000072239 GCCGTCGTATTACAACGTCGT pLKO.1 lacZ.1 CDS 100% 2.160 N/A N/A lacZ
20 TRCN0000231700 GCCGTCGTATTACAACGTCGT pLKO_TRC005 lacZ.1 CDS 100% 2.160 N/A N/A lacZ
21 TRCN0000072234 CGGATTCTCTGGCCGTCGTAT pLKO.1 lacZ.1 CDS 100% 1.650 N/A N/A lacZ
22 TRCN0000072229 GCGATCGTAATCACCCGAGTG pLKO.1 lacZ.1 CDS 100% 0.750 N/A N/A lacZ
23 TRCN0000231712 GCGATCGTAATCACCCGAGTG pLKO_TRC005 lacZ.1 CDS 100% 0.750 N/A N/A lacZ
24 TRCN0000072224 CGCGATCGTAATCACCCGAGT pLKO.1 lacZ.1 CDS 100% 0.720 N/A N/A lacZ
25 TRCN0000231722 CGCGATCGTAATCACCCGAGT pLKO_TRC005 lacZ.1 CDS 100% 0.720 N/A N/A lacZ
26 TRCN0000072225 CTCTGGCTAACGGTACGCGTA pLKO.1 lacZ.1 CDS 100% 0.720 N/A N/A lacZ
27 TRCN0000072241 GCGTTGGCAATTTAACCGCCA pLKO.1 lacZ.1 CDS 100% 0.540 N/A N/A lacZ
28 TRCN0000231704 GCGTTGGCAATTTAACCGCCA pLKO_TRC005 lacZ.1 CDS 100% 0.540 N/A N/A lacZ
29 TRCN0000072223 TGTTCGCATTATCCGAACCAT pLKO.1 lacZ.1 CDS 100% 0.300 N/A N/A lacZ
30 TRCN0000231726 TGTTCGCATTATCCGAACCAT pLKO_TRC005 lacZ.1 CDS 100% 0.300 N/A N/A lacZ
31 TRCN0000072228 ACTCTGGCTAACGGTACGCGT pLKO.1 lacZ.1 CDS 100% 0.220 N/A N/A lacZ
32 TRCN0000231713 ACTCTGGCTAACGGTACGCGT pLKO_TRC005 lacZ.1 CDS 100% 0.220 N/A N/A lacZ
33 TRCN0000072230 CCCGTCAGTATCGGCGGAATT pLKO.1 lacZ.1 CDS 100% 0.000 N/A N/A lacZ
34 TRCN0000231711 CCCGTCAGTATCGGCGGAATT pLKO_TRC005 lacZ.1 CDS 100% 0.000 N/A N/A lacZ
35 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT pLKO.1 lacZ.1 CDS 100% 0.000 N/A N/A lacZ
36 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT pLKO_TRC005 lacZ.1 CDS 100% 0.000 N/A N/A lacZ
37 TRCN0000072227 GCGCTAATCACGACGCGCTGT pLKO.1 lacZ.1 CDS 100% 0.000 N/A N/A lacZ
38 TRCN0000231708 GCGCTAATCACGACGCGCTGT pLKO_TRC005 lacZ.1 CDS 100% 0.000 N/A N/A lacZ
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -15 (lacZ), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 BRDN0000464771 CONTROL lacZ.1 -15 lacZ pDONR223 0% 91.7% 92.1% None (many diffs)
2 ccsbBroad301_99994 CONTROL lacZ.1 -15 lacZ pLX_TRC301 0% 91.7% 92.1% None (many diffs)
3 ccsbBroad301_99995 CONTROL lacZ.1 -15 lacZ pLX_TRC301 0% 91.7% 92.1% None (many diffs)
4 ccsbBroad301_99996 CONTROL lacZ.1 -15 lacZ pLX_TRC301 0% 91.7% 92.1% None (many diffs)
5 ccsbBroad301_99983 CONTROL lacZ.1 -15 lacZ pLX_TRC301 0% 91.7% 92.1% None (many diffs)
6 ccsbBroad304_99994 CONTROL lacZ.1 -15 lacZ pLX_TRC304 3.4% 91.7% 92.1% V5 (many diffs)
7 ccsbBroad304_99996 CONTROL lacZ.1 -15 lacZ pLX_TRC304 3.4% 91.7% 92.1% V5 (many diffs)
8 ccsbBroad304_99995 CONTROL lacZ.1 -15 lacZ pLX_TRC304 3.4% 91.7% 92.1% V5 (many diffs)
9 BRDN0000559441 CONTROL lacZ.1 -15 lacZ pLX_TRC307 0% 91.7% 92.1% V5 (many diffs)
10 BRDN0000464780 CONTROL lacZ.1 -15 lacZ pLX_TRC302 0% 91.7% 92.1% V5 (many diffs)
11 BRDN0000556272 CONTROL lacZ.1 -15 lacZ pLX_TRC303 0% 91.7% 92.1% None (many diffs)
12 BRDN0000556278 CONTROL lacZ.1 -15 lacZ pLX_TRC305 0% 91.7% 92.1% None (many diffs)
13 BRDN0000556288 CONTROL lacZ.1 -15 lacZ pLX_TRC306 0% 91.7% 92.1% V5 (many diffs)
14 BRDN0000556266 CONTROL lacZ.1 -15 lacZ pLXI_TRC401 0% 91.7% 92.1% None (many diffs)
15 BRDN0000556290 CONTROL lacZ.1 -15 lacZ pLXI_TRC402 0% 91.7% 92.1% HA (many diffs)
16 BRDN0000556291 CONTROL lacZ.1 -15 lacZ pLX_TRC311 0% 91.7% 92.1% V5 (many diffs)
17 BRDN0000556274 CONTROL lacZ.1 -15 lacZ pLX_TRC312 0% 91.7% 92.1% V5 (many diffs)
18 BRDN0000556300 CONTROL lacZ.1 -15 lacZ pLX_TRC313 0% 91.7% 92.1% V5 (many diffs)
19 BRDN0000556279 CONTROL lacZ.1 -15 lacZ pLX_TRC314 0% 91.7% 92.1% V5 (many diffs)
20 BRDN0000556294 CONTROL lacZ.1 -15 lacZ pLX_TRC315 0% 91.7% 92.1% V5 (many diffs)
21 BRDN0000556277 CONTROL lacZ.1 -15 lacZ pLXI_TRC403 0% 91.7% 92.1% V5 (many diffs)
22 BRDN0000464772 CONTROL lacZ.1 -15 lacZ pDONR223 0% 91.7% 92.1% None (many diffs)
23 BRDN0000464773 CONTROL lacZ.1 -15 lacZ pDONR223 0% 91.7% 92.1% None (many diffs)
Download CSV