Gene: GFP (-10)

clonetechGfp

Taxon:
Control
Chromosome:
n/a
Wildtype Transcripts:
clonetechGfp.1

shRNA constructs with 100% match to this gene

Matching is performed using the Specificity-Defining Region (SDR)[?] of the shRNAs. This list includes matches to any current transcript from gene -10 (GFP), regardless of what transcript the shRNAs were originally designed to target. For example, some shRNAs in this list may have been originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Clone ID Target Seq Vector Matching Transcripts for Gene Match Regions[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072181 ACAACAGCCACAACGTCTATA pLKO.1 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
2 TRCN0000231753 ACAACAGCCACAACGTCTATA pLKO_TRC005 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
3 TRCN0000559393 ACAACAGCCACAACGTCTATA pLKO_TRC024 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
4 TRCN0000559394 ACAACAGCCACAACGTCTATA pLKO_TRC047 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
5 TRCN0000559395 ACAACAGCCACAACGTCTATA pLKO_TRC022 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
6 TRCN0000559396 ACAACAGCCACAACGTCTATA pLKO_TRC018 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
7 TRCN0000559397 ACAACAGCCACAACGTCTATA pLKO_TRC016 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
8 TRCN0000559399 ACAACAGCCACAACGTCTATA pLKO_TRC023 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
9 TRCN0000559401 ACAACAGCCACAACGTCTATA pLKO_TRC008 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
10 TRCN0000559403 ACAACAGCCACAACGTCTATA pLKO_TRC046 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
11 TRCN0000559407 ACAACAGCCACAACGTCTATA pLKO_TRC017 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
12 TRCN0000559408 ACAACAGCCACAACGTCTATA pLKO_TRC021 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
13 TRCN0000072178 CAACAGCCACAACGTCTATAT pLKO.1 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
14 TRCN0000231750 CAACAGCCACAACGTCTATAT pLKO_TRC005 clonetechGfp.1 CDS 100% 13.200 N/A N/A GFP
15 TRCN0000072193 CGACGTAAACGGCCACAAGTT pLKO.1 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
16 TRCN0000231761 CGACGTAAACGGCCACAAGTT pLKO_TRC005 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
17 TRCN0000072192 GAACGGCATCAAGGTGAACTT pLKO.1 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
18 TRCN0000231760 GAACGGCATCAAGGTGAACTT pLKO_TRC005 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
19 TRCN0000072185 TACAACAGCCACAACGTCTAT pLKO.1 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
20 TRCN0000231747 TACAACAGCCACAACGTCTAT pLKO_TRC005 clonetechGfp.1 CDS 100% 4.950 N/A N/A GFP
21 TRCN0000072194 CCACATGAAGCAGCACGACTT pLKO.1 clonetechGfp.1 CDS 100% 4.050 N/A N/A GFP
22 TRCN0000231762 CCACATGAAGCAGCACGACTT pLKO_TRC005 clonetechGfp.1 CDS 100% 4.050 N/A N/A GFP
23 TRCN0000072180 CTATATCATGGCCGACAAGCA pLKO.1 clonetechGfp.1 CDS 100% 2.640 N/A N/A GFP
24 TRCN0000231754 CTATATCATGGCCGACAAGCA pLKO_TRC005 clonetechGfp.1 CDS 100% 2.640 N/A N/A GFP
25 TRCN0000072199 TGACCCTGAAGTTCATCTGCA pLKO.1 clonetechGfp.1 CDS 100% 2.640 N/A N/A GFP
26 TRCN0000231745 TGACCCTGAAGTTCATCTGCA pLKO_TRC005 clonetechGfp.1 CDS 100% 2.640 N/A N/A GFP
27 TRCN0000072196 ACGTCTATATCATGGCCGACA pLKO.1 clonetechGfp.1 CDS 100% 2.160 N/A N/A GFP
28 TRCN0000231756 ACGTCTATATCATGGCCGACA pLKO_TRC005 clonetechGfp.1 CDS 100% 2.160 N/A N/A GFP
29 TRCN0000072200 AGTACAACTACAACAGCCACA pLKO.1 clonetechGfp.1 CDS 100% 2.160 N/A N/A GFP
30 TRCN0000231744 AGTACAACTACAACAGCCACA pLKO_TRC005 clonetechGfp.1 CDS 100% 2.160 N/A N/A GFP
31 TRCN0000072183 CGGCATGGACGAGCTGTACAA pLKO.1 clonetechGfp.1 CDS 100% 1.650 N/A N/A GFP
32 TRCN0000231751 CGGCATGGACGAGCTGTACAA pLKO_TRC005 clonetechGfp.1 CDS 100% 1.650 N/A N/A GFP
33 TRCN0000072195 GCGACGTAAACGGCCACAAGT pLKO.1 clonetechGfp.1 CDS 100% 1.650 N/A N/A GFP
34 TRCN0000231755 GCGACGTAAACGGCCACAAGT pLKO_TRC005 clonetechGfp.1 CDS 100% 1.650 N/A N/A GFP
35 TRCN0000072197 CTACGGCAAGCTGACCCTGAA pLKO.1 clonetechGfp.1 CDS 100% 1.350 N/A N/A GFP
36 TRCN0000231757 CTACGGCAAGCTGACCCTGAA pLKO_TRC005 clonetechGfp.1 CDS 100% 1.350 N/A N/A GFP
37 TRCN0000072182 TCTCGGCATGGACGAGCTGTA pLKO.1 clonetechGfp.1 CDS 100% 1.350 N/A N/A GFP
38 TRCN0000231752 TCTCGGCATGGACGAGCTGTA pLKO_TRC005 clonetechGfp.1 CDS 100% 1.350 N/A N/A GFP
39 TRCN0000072186 TGCCCGACAACCACTACCTGA pLKO.1 clonetechGfp.1 CDS 100% 0.880 N/A N/A GFP
40 TRCN0000231746 TGCCCGACAACCACTACCTGA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.880 N/A N/A GFP
41 TRCN0000072179 CGACCACATGAAGCAGCACGA pLKO.1 clonetechGfp.1 CDS 100% 0.720 N/A N/A GFP
42 TRCN0000231749 CGACCACATGAAGCAGCACGA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.720 N/A N/A GFP
43 TRCN0000072190 GACCACATGAAGCAGCACGAC pLKO.1 clonetechGfp.1 CDS 100% 0.720 N/A N/A GFP
44 TRCN0000231759 GACCACATGAAGCAGCACGAC pLKO_TRC005 clonetechGfp.1 CDS 100% 0.720 N/A N/A GFP
45 TRCN0000206973 GCACGACTTCTTCAAGTCCGC pLKO.1 clonetechGfp.1 CDS 100% 0.018 N/A N/A GFP
46 TRCN0000207152 AGTTCGTGACCGCCGCCGGGA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
47 TRCN0000072188 CCCGACCACATGAAGCAGCAC pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
48 TRCN0000231763 CCCGACCACATGAAGCAGCAC pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
49 TRCN0000072189 CCTACGGCGTGCAGTGCTTCA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
50 TRCN0000231765 CCTACGGCGTGCAGTGCTTCA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
51 TRCN0000072184 CGGGATCACTCTCGGCATGGA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
52 TRCN0000231748 CGGGATCACTCTCGGCATGGA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
53 TRCN0000072187 CTCTCGGCATGGACGAGCTGT pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
54 TRCN0000231764 CTCTCGGCATGGACGAGCTGT pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
55 TRCN0000207020 GACCACCCTGACCTACGGCGT pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
56 TRCN0000072202 GCCACAACATCGAGGACGGCA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
57 TRCN0000231705 GCCACAACATCGAGGACGGCA pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
58 TRCN0000207065 GCGATCACATGGTCCTGCTGG pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
59 TRCN0000072198 GCGCGATCACATGGTCCTGCT pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
60 TRCN0000231758 GCGCGATCACATGGTCCTGCT pLKO_TRC005 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
61 TRCN0000207257 GCTGTTCACCGGGGTGGTGCC pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
62 TRCN0000072201 GTCGAGCTGGACGGCGACGTA pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
63 TRCN0000207114 TCCGCCCTGAGCAAAGACCCC pLKO.1 clonetechGfp.1 CDS 100% 0.000 N/A N/A GFP
Download CSV

shRNA constructs with at least a near match to this gene

This list includes shRNAs that have a >84% (16 of 19 bases) SDR[?] match to transcripts from gene -10 (GFP), regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (ii) a transcript of a different gene from the same or different taxon.

Download CSV

ORF constructs matching current transcripts from this gene

Clone ID Taxon Transcript Gene Symbol DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Note
1 ccsbBroad301_99984 CONTROL clonetechGfp.1 -10 GFP pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
2 ccsbBroad301_99997 CONTROL clonetechGfp.1 -10 GFP pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
3 ccsbBroad301_99998 CONTROL clonetechGfp.1 -10 GFP pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
4 ccsbBroad301_99999 CONTROL clonetechGfp.1 -10 GFP pLX_TRC301 0% 99.7% 99.5% None 93C>T;491T>C
5 ccsbBroad304_99997 CONTROL clonetechGfp.1 -10 GFP pLX_TRC304 71.7% 99.7% 99.5% V5 (not translated due to frame shift) 93C>T;491T>C
6 ccsbBroad304_99998 CONTROL clonetechGfp.1 -10 GFP pLX_TRC304 71.7% 99.7% 99.5% V5 (not translated due to frame shift) 93C>T;491T>C
7 ccsbBroad304_99999 CONTROL clonetechGfp.1 -10 GFP pLX_TRC304 72.2% 99.7% 99.5% V5 (not translated due to frame shift) 93C>T;491T>C
8 BRDN0000559443 CONTROL clonetechGfp.1 -10 GFP pLX_TRC307 0% 99.7% 99.5% V5 93C>T;491T>C
9 BRDN0000464774 CONTROL clonetechGfp.1 -10 GFP pDONR221 0% 99.7% 99.5% None 93C>T;491T>C
10 BRDN0000464781 CONTROL clonetechGfp.1 -10 GFP pLX_TRC302 0% 99.7% 99.5% V5 93C>T;491T>C
11 BRDN0000556273 CONTROL clonetechGfp.1 -10 GFP pLX_TRC303 0% 99.7% 99.5% None 93C>T;491T>C
12 BRDN0000556285 CONTROL clonetechGfp.1 -10 GFP pLX_TRC305 0% 99.7% 99.5% None 93C>T;491T>C
13 BRDN0000556297 CONTROL clonetechGfp.1 -10 GFP pLX_TRC306 0% 99.7% 99.5% V5 93C>T;491T>C
14 BRDN0000556276 CONTROL clonetechGfp.1 -10 GFP pLXI_TRC401 0% 99.7% 99.5% None 93C>T;491T>C
15 BRDN0000556271 CONTROL clonetechGfp.1 -10 GFP pLXI_TRC402 0% 99.7% 99.5% HA 93C>T;491T>C
16 BRDN0000556283 CONTROL clonetechGfp.1 -10 GFP pLX_TRC311 0% 99.7% 99.5% V5 93C>T;491T>C
17 BRDN0000556281 CONTROL clonetechGfp.1 -10 GFP pLX_TRC313 0% 99.7% 99.5% V5 93C>T;491T>C
18 BRDN0000556292 CONTROL clonetechGfp.1 -10 GFP pLX_TRC314 0% 99.7% 99.5% V5 93C>T;491T>C
19 BRDN0000556298 CONTROL clonetechGfp.1 -10 GFP pLX_TRC315 0% 99.7% 99.5% V5 93C>T;491T>C
20 BRDN0000556286 CONTROL clonetechGfp.1 -10 GFP pLXI_TRC403 0% 99.7% 99.5% V5 93C>T;491T>C
21 BRDN0000464775 CONTROL clonetechGfp.1 -10 GFP pDONR221 0% 99.7% 99.5% None 93C>T;491T>C
22 BRDN0000464776 CONTROL clonetechGfp.1 -10 GFP pDONR221 0% 99.7% 99.5% None 93C>T;491T>C
23 BRDN0000464762 CONTROL clonetechGfp.1 -10 GFP pDONR223 0% 99.1% 97.9% None (many diffs)
24 ccsbBroad301_99980 CONTROL clonetechGfp.1 -10 GFP pLX_TRC301 0% 99.1% 97.9% None (many diffs)
25 ccsbBroad301_99985 CONTROL clonetechGfp.1 -10 GFP pLX_TRC301 0% 99.1% 97.9% None (many diffs)
26 ccsbBroad301_99986 CONTROL clonetechGfp.1 -10 GFP pLX_TRC301 0% 99.1% 97.9% None (many diffs)
27 ccsbBroad301_99987 CONTROL clonetechGfp.1 -10 GFP pLX_TRC301 0% 99.1% 97.9% None (many diffs)
28 ccsbBroad304_99986 CONTROL clonetechGfp.1 -10 GFP pLX_TRC304 82.4% 99.1% 97.9% V5 (many diffs)
29 BRDN0000464777 CONTROL clonetechGfp.1 -10 GFP pLX_TRC302 0% 99.1% 97.9% V5 (many diffs)
30 ccsbBroad304_99985 CONTROL clonetechGfp.1 -10 GFP pLX_TRC304 72.2% 99% 97.4% V5 (not translated due to prior stop codon) (many diffs)
31 ccsbBroad304_99987 CONTROL clonetechGfp.1 -10 GFP pLX_TRC304 88.7% 98.8% 23.1% V5 (not translated due to frame shift) (many diffs)
32 BRDN0000464763 CONTROL clonetechGfp.1 -10 GFP pDONR223 0% 99.1% 97.9% None (many diffs)
33 BRDN0000464764 CONTROL clonetechGfp.1 -10 GFP pDONR223 0% 99.1% 97.9% None (many diffs)
Download CSV