Construct: Neg. Control TRCN0000559420

Construct Description:

Construct Type:
Neg. Control
Other Identifiers:
pRosetta
DNA Barcode:
ACACTCGAGCACTTTTTGAAT

Vector Information:

Vector Backbone:
pLKO_TRC060
Pol II Cassette 1:
PGK-PuroR-2A-BlastR
Pol II Cassette 2:
2A-eGFP
Pol III Promoter:
constitutive hU6
Pol III Insert:
None
Selection Marker:
PuroR-2A-BlastR
Visible Reporter:
eGFP

Sequence Information:

Vector insert sequence:
5'-CCGG-ACACTCGAGCACTTTTTG-AATT-3'

Other non-shRNA clones in this vector:

(none)