Construct: Neg. Control TRCN0000559420

Construct Description:

Construct Type:
Neg. Control
Other Identifiers:
, pRosetta
DNA Barcode:
ACACTCGAGCACTTTTTGAAT
Vector:
pLKO_TRC060

Sequence Information:

Vector insert sequence:
5'-CCGG-ACACTCGAGCACTTTTTG-AATT-3'

Other non-shRNA clones in this vector:

(none)