Construct: Neg. Control TRCN0000241923

Construct Description:

Construct Type:
Neg. Control
Other Identifiers:
pLKO_TRC005-nullT, TRC005_nullT, pLKO_TRC025
DNA Barcode:
ACAGTTAACCACTTTTTGAAT

Vector Information:

Vector Backbone:
pLKO_TRC005
Pol II Cassette 1:
PGK-PuroR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
(TRCN0000241923)
Selection Marker:
PuroR
Visible Reporter:
n/a

Sequence Information:

Vector insert sequence:
5'-CCGG-ACAGTTAACCACTTTTTG-AATT-3'

Other non-shRNA clones in this vector:

(none)