Construct: TRCN0000231765

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_197s21c1
DNA Barcode:
CCTACGGCGTGCAGTGCTTCA
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 197 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 197 0.000 N/A
2 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 197 0.000 N/A
3 human 5609 MAP2K7 JNK kinase 2 NM_145185.2 80% 89% CDS 595 N/A N/A
4 human 166752 FREM3 Fras1 related extracellular... NM_001168235.1 80% 89% CDS 6322 N/A N/A
5 mouse 13557 E2f3 E2F transcription factor 3 NM_010093.3 80% 89% 3UTR 4795 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCTACGGCGTGCAGTGCTTCA
Hairpin Sequence:
5'-CCGG-CCTACGGCGTGCAGTGCTTCA-CTCGAG-TGAAGCACTGCACGCCGTAGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCTACGGCGTGCAGTGCTTCACTCGAGTGAAGCACTGCACGCCGTAGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCTACGGCGTGCAGTGCTTCACTCGAGTGAAGCACTGCACGCCGTAGG-3'

Other clones with same target sequence:

  1. TRCN0000072189