Construct: TRCN0000231762

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_231s21c1
DNA Barcode:
CCACATGAAGCAGCACGACTT
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 231 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 231 4.050 N/A
2 CONTROL -40 BFP BFP BFP.1 100% 100% CDS 231 4.050 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 231 4.050 N/A
4 human 22801 ITGA11 integrin, alpha 11 NM_001004439.1 81% 85% CDS 215 N/A N/A
5 mouse 114875 Plcz1 phospholipase C zeta NM_054066.4 85% 89% CDS 1854 N/A N/A
6 mouse 73904 4833412C05Rik RIKEN cDNA 4833412C05 gene NR_045954.1 85% 89% 3UTR 22 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CCACATGAAGCAGCACGACTT
Hairpin Sequence:
5'-CCGG-CCACATGAAGCAGCACGACTT-CTCGAG-AAGTCGTGCTGCTTCATGTGG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCCACATGAAGCAGCACGACTTCTCGAGAAGTCGTGCTGCTTCATGTGGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACCACATGAAGCAGCACGACTTCTCGAGAAGTCGTGCTGCTTCATGTGG-3'

Other clones with same target sequence:

  1. TRCN0000072194