Construct: TRCN0000231759

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_229s21c1
DNA Barcode:
GACCACATGAAGCAGCACGAC
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 229 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 229 0.720 N/A
2 CONTROL -40 BFP BFP BFP.1 100% 100% CDS 229 0.720 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 229 0.720 N/A
4 mouse 229584 Pogz pogo transposable element w... NM_001165948.1 80% 89% CDS 1670 N/A N/A
5 mouse 229584 Pogz pogo transposable element w... NM_172683.3 80% 89% CDS 1697 N/A N/A
6 mouse 13801 Enam enamelin NM_017468.3 80% 89% CDS 739 N/A N/A
7 mouse 73942 Fam151b family with sequence simila... NM_001163627.1 80% 89% CDS 431 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GACCACATGAAGCAGCACGAC
Hairpin Sequence:
5'-CCGG-GACCACATGAAGCAGCACGAC-CTCGAG-GTCGTGCTGCTTCATGTGGTC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGACCACATGAAGCAGCACGACCTCGAGGTCGTGCTGCTTCATGTGGTCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGACCACATGAAGCAGCACGACCTCGAGGTCGTGCTGCTTCATGTGGTC-3'

Other clones with same target sequence:

  1. TRCN0000072190