Construct: TRCN0000231758

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_645s21c1
DNA Barcode:
GCGCGATCACATGGTCCTGCT
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 645 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript Match %[?] SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% 100% CDS 645 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 100% 100% CDS 645 0.000 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% 100% CDS 645 0.000 N/A
4 human 10045 SH2D3A SH2 domaincontaining 3A NM_005490.2 80% 89% CDS 1704 N/A N/A
5 human 100509256 LOC100509256 uncharacterized LOC100509256 XR_113292.2 81% 85% 3UTR 254 N/A N/A
6 mouse 353187 Nr1d2 Reverb beta NM_011584.4 77% 85% 5UTR 81 N/A N/A
Download CSV

Sequence Information

Target Sequence:
GCGCGATCACATGGTCCTGCT
Hairpin Sequence:
5'-CCGG-GCGCGATCACATGGTCCTGCT-CTCGAG-AGCAGGACCATGTGATCGCGC-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGGCGCGATCACATGGTCCTGCTCTCGAGAGCAGGACCATGTGATCGCGCTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAAGCGCGATCACATGGTCCTGCTCTCGAGAGCAGGACCATGTGATCGCGC-3'

Other clones with same target sequence:

  1. TRCN0000072198