Construct: shRNA TRCN0000231757

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_117s21c1
DNA Barcode:
CTACGGCAAGCTGACCCTGAA
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 117 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 117 1.350 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 117 1.350 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 117 1.350 N/A
4 human 3204 HOXA7 homeobox A7 NM_006896.3 89% CDS 360 N/A N/A
5 human 23413 NCS1 neuronal calcium sensor 1 NM_001128826.1 89% CDS 435 N/A N/A
6 human 23413 NCS1 neuronal calcium sensor 1 NM_014286.3 89% CDS 566 N/A N/A
7 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NM_001011649.1 85% CDS 5295 N/A N/A
8 human 55755 CDK5RAP2 CDK5 regulatory subunit ass... NM_018249.4 85% CDS 5532 N/A N/A
9 human 25809 TTLL1 tubulin tyrosine ligase-lik... NR_027779.1 80% 3UTR 1293 N/A N/A
10 human 100287036 LOC100287036 uncharacterized LOC100287036 NM_001242885.1 95% 5UTR 86 N/A N/A
11 mouse 18212 Ntrk2 neurotrophic tyrosine kinas... NM_001025074.1 89% CDS 2766 N/A N/A
12 mouse 14027 Evpl envoplakin NM_025276.3 89% CDS 4412 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CTACGGCAAGCTGACCCTGAA
Hairpin Sequence:
5'-CCGG-CTACGGCAAGCTGACCCTGAA-CTCGAG-TTCAGGGTCAGCTTGCCGTAG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCTACGGCAAGCTGACCCTGAACTCGAGTTCAGGGTCAGCTTGCCGTAGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACTACGGCAAGCTGACCCTGAACTCGAGTTCAGGGTCAGCTTGCCGTAG-3'

Other clones with same target sequence:

  1. TRCN0000072197