Construct: shRNA TRCN0000231751

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_696s21c1
DNA Barcode:
CGGCATGGACGAGCTGTACAA
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 696 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 696 1.650 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 696 1.650 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 696 1.650 N/A
4 human 9865 TRIL TLR4 interactor with leucin... NM_014817.3 89% CDS 689 N/A N/A
5 mouse 380684 Nefh neurofilament, heavy polype... NM_010904.3 89% CDS 544 N/A N/A
6 mouse 108989 Tpr translocated promoter region NM_133780.3 85% CDS 1242 N/A N/A
7 mouse 667422 Gm8623 predicted gene 8623 XR_140884.1 81% 3UTR 69 N/A N/A
8 mouse 667422 Gm8623 predicted gene 8623 XR_142283.1 81% 3UTR 69 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGGCATGGACGAGCTGTACAA
Hairpin Sequence:
5'-CCGG-CGGCATGGACGAGCTGTACAA-CTCGAG-TTGTACAGCTCGTCCATGCCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGGCATGGACGAGCTGTACAACTCGAGTTGTACAGCTCGTCCATGCCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGGCATGGACGAGCTGTACAACTCGAGTTGTACAGCTCGTCCATGCCG-3'

Other clones with same target sequence:

  1. TRCN0000072183