Construct: shRNA TRCN0000231749

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_228s21c1
DNA Barcode:
CGACCACATGAAGCAGCACGA
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 228 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 228 0.720 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 228 0.720 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 228 0.720 N/A
4 human 55226 NAT10 N-acetyltransferase 10 (GCN... XM_005252999.1 85% CDS 3017 N/A N/A
5 human 63977 PRDM15 PR domain containing 15 NM_001040424.2 89% CDS 2508 N/A N/A
6 human 63977 PRDM15 PR domain containing 15 NM_001282934.1 89% CDS 2568 N/A N/A
7 human 63977 PRDM15 PR domain containing 15 NM_022115.4 89% CDS 3495 N/A N/A
8 human 63977 PRDM15 PR domain containing 15 NR_104257.1 89% 3UTR 2516 N/A N/A
9 human 63977 PRDM15 PR domain containing 15 NR_104258.1 89% 3UTR 2396 N/A N/A
10 human 63977 PRDM15 PR domain containing 15 NR_104260.1 89% 3UTR 2363 N/A N/A
11 human 63977 PRDM15 PR domain containing 15 XM_006724039.1 89% CDS 2325 N/A N/A
12 human 63977 PRDM15 PR domain containing 15 XM_006724040.1 89% CDS 2265 N/A N/A
13 mouse 114875 Plcz1 phospholipase C, zeta 1 NM_054066.4 89% CDS 1851 N/A N/A
14 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506899.1 89% CDS 1787 N/A N/A
15 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506900.1 89% CDS 1787 N/A N/A
16 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506901.1 89% CDS 1787 N/A N/A
17 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506902.1 89% CDS 1817 N/A N/A
18 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506903.1 89% CDS 1895 N/A N/A
19 mouse 114875 Plcz1 phospholipase C, zeta 1 XM_006506904.1 89% CDS 1036 N/A N/A
20 mouse 13801 Enam enamelin NM_017468.3 89% CDS 738 N/A N/A
21 mouse 17188 Maz MYC-associated zinc finger ... NM_010772.1 89% CDS 1281 N/A N/A
22 mouse 17188 Maz MYC-associated zinc finger ... XM_006507402.1 89% CDS 1355 N/A N/A
23 mouse 17188 Maz MYC-associated zinc finger ... XM_006507403.1 89% CDS 1355 N/A N/A
24 mouse 73942 Fam151b family with sequence simila... NM_001163627.1 89% CDS 430 N/A N/A
25 mouse 73942 Fam151b family with sequence simila... XM_006517777.1 89% CDS 258 N/A N/A
26 mouse 100579151 Gm16833 predicted gene, 16833 NR_045754.1 89% 3UTR 511 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGACCACATGAAGCAGCACGA
Hairpin Sequence:
5'-CCGG-CGACCACATGAAGCAGCACGA-CTCGAG-TCGTGCTGCTTCATGTGGTCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGACCACATGAAGCAGCACGACTCGAGTCGTGCTGCTTCATGTGGTCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGACCACATGAAGCAGCACGACTCGAGTCGTGCTGCTTCATGTGGTCG-3'

Other clones with same target sequence:

  1. TRCN0000072179