Construct: shRNA TRCN0000231748

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_684s21c1
DNA Barcode:
CGGGATCACTCTCGGCATGGA
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 684 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 684 0.000 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 684 0.000 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 684 0.000 N/A
4 mouse 109711 Actn1 actinin, alpha 1 NM_134156.2 89% CDS 2558 N/A N/A
5 mouse 109711 Actn1 actinin, alpha 1 XM_006515384.1 89% CDS 2437 N/A N/A
6 mouse 109711 Actn1 actinin, alpha 1 XM_006515385.1 89% CDS 2437 N/A N/A
7 mouse 109711 Actn1 actinin, alpha 1 XM_006515387.1 89% CDS 2675 N/A N/A
8 mouse 109711 Actn1 actinin, alpha 1 XM_006515389.1 89% CDS 2257 N/A N/A
9 mouse 109711 Actn1 actinin, alpha 1 XM_006515390.1 89% CDS 1688 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGGGATCACTCTCGGCATGGA
Hairpin Sequence:
5'-CCGG-CGGGATCACTCTCGGCATGGA-CTCGAG-TCCATGCCGAGAGTGATCCCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGGGATCACTCTCGGCATGGACTCGAGTCCATGCCGAGAGTGATCCCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGGGATCACTCTCGGCATGGACTCGAGTCCATGCCGAGAGTGATCCCG-3'

Other clones with same target sequence:

  1. TRCN0000072184