Construct: shRNA TRCN0000231747

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_436s21c1
DNA Barcode:
TACAACAGCCACAACGTCTAT
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 436 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 436 4.950 N/A
2 CONTROL -40 BFP BFP BFP.1 94% CDS 436 N/A N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 436 4.950 N/A
4 human 5794 PTPRH protein tyrosine phosphatas... NM_001161440.1 85% CDS 307 N/A N/A
5 human 5794 PTPRH protein tyrosine phosphatas... NM_002842.3 85% CDS 307 N/A N/A
6 human 3705 ITPK1 inositol-tetrakisphosphate ... NM_001142593.1 89% CDS 856 N/A N/A
7 human 3705 ITPK1 inositol-tetrakisphosphate ... NM_001142594.1 89% CDS 977 N/A N/A
8 human 3705 ITPK1 inositol-tetrakisphosphate ... NM_014216.4 89% CDS 977 N/A N/A
9 human 24137 KIF4A kinesin family member 4A NM_012310.4 89% CDS 1216 N/A N/A
10 human 219285 SAMD9L sterile alpha motif domain ... NM_152703.2 85% 3UTR 7001 N/A N/A
11 human 352954 GATS GATS, stromal antigen 3 opp... NR_028038.1 89% 3UTR 3338 N/A N/A
12 human 285643 KIF4B kinesin family member 4B NM_001099293.1 89% CDS 1233 N/A N/A
13 human 100506877 LOC100506877 uncharacterized LOC100506877 XR_109739.1 80% 3UTR 90 N/A N/A
14 mouse 30046 Zfp292 zinc finger protein 292 NM_013889.2 85% CDS 4288 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TACAACAGCCACAACGTCTAT
Hairpin Sequence:
5'-CCGG-TACAACAGCCACAACGTCTAT-CTCGAG-ATAGACGTTGTGGCTGTTGTA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTACAACAGCCACAACGTCTATCTCGAGATAGACGTTGTGGCTGTTGTATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATACAACAGCCACAACGTCTATCTCGAGATAGACGTTGTGGCTGTTGTA-3'

Other clones with same target sequence:

  1. TRCN0000072185