Construct: shRNA TRCN0000231745

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_128s21c1
DNA Barcode:
TGACCCTGAAGTTCATCTGCA
Vector:
pLKO_TRC005

Original Target:

Taxon:
CONTROL
Gene:
Clontech GFP
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 128 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 128 2.640 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 128 2.640 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 128 2.640 N/A
4 human 86614 HSFY1 heat shock transcription fa... NR_003510.1 85% 3UTR 1187 N/A N/A
5 human 159119 HSFY2 heat shock transcription fa... NR_003509.1 85% 3UTR 1207 N/A N/A
6 human 89874 SLC25A21 solute carrier family 25 (m... NM_001171170.1 90% 3UTR 1258 N/A N/A
7 human 89874 SLC25A21 solute carrier family 25 (m... NM_030631.3 90% 3UTR 3435 N/A N/A
8 human 55356 SLC22A15 solute carrier family 22, m... NM_018420.2 89% CDS 1056 N/A N/A
9 human 79895 ATP8B4 ATPase, class I, type 8B, m... NM_024837.2 89% CDS 3327 N/A N/A
10 human 100509498 LOC100509498 uncharacterized LOC100509498 XR_111605.1 89% 3UTR 57 N/A N/A
11 mouse 24135 Zfp68 zinc finger protein 68 NM_001044747.2 85% 5UTR 212 N/A N/A
12 mouse 24135 Zfp68 zinc finger protein 68 NM_001163797.1 85% 5UTR 212 N/A N/A
13 mouse 24135 Zfp68 zinc finger protein 68 NM_013844.2 85% 5UTR 212 N/A N/A
14 mouse 108682 Gpt2 glutamic pyruvate transamin... NM_173866.3 89% CDS 869 N/A N/A
15 mouse 242126 Slc22a15 solute carrier family 22 (o... NM_001039371.2 89% CDS 1261 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGACCCTGAAGTTCATCTGCA
Hairpin Sequence:
5'-CCGG-TGACCCTGAAGTTCATCTGCA-CTCGAG-TGCAGATGAACTTCAGGGTCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGACCCTGAAGTTCATCTGCACTCGAGTGCAGATGAACTTCAGGGTCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGACCCTGAAGTTCATCTGCACTCGAGTGCAGATGAACTTCAGGGTCA-3'

Other clones with same target sequence:

  1. TRCN0000072199