Construct: shRNA TRCN0000231745

Construct Description:

Construct Type:
shRNA
Other Identifiers:
clonetechGfp_128s21c1
DNA Barcode:
TGACCCTGAAGTTCATCTGCA
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
GFP (-10)
Gene Description:
clonetechGfp
Transcript:
clonetech clonetechGfp.1 (CURRENT)
Match location:
Position 128 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -10 GFP clonetechGfp clonetechGfp.1 100% CDS 128 2.640 N/A
2 CONTROL -40 BFP BFP BFP.1 100% CDS 128 2.640 N/A
3 CONTROL -44 eGFP eGFP eGFP.1 100% CDS 128 2.640 N/A
4 human 55356 SLC22A15 solute carrier family 22, m... NM_018420.2 89% CDS 1056 N/A N/A
5 human 55356 SLC22A15 solute carrier family 22, m... XM_005271004.1 89% CDS 1004 N/A N/A
6 human 55356 SLC22A15 solute carrier family 22, m... XM_005271005.1 89% CDS 745 N/A N/A
7 human 55356 SLC22A15 solute carrier family 22, m... XM_005271006.1 89% 3UTR 967 N/A N/A
8 human 55356 SLC22A15 solute carrier family 22, m... XM_006710753.1 89% CDS 777 N/A N/A
9 human 55356 SLC22A15 solute carrier family 22, m... XM_006710754.1 89% CDS 304 N/A N/A
10 human 55356 SLC22A15 solute carrier family 22, m... XR_426619.1 89% 3UTR 1004 N/A N/A
11 human 55356 SLC22A15 solute carrier family 22, m... XR_426620.1 89% 3UTR 1004 N/A N/A
12 human 55356 SLC22A15 solute carrier family 22, m... XR_426621.1 89% 3UTR 1004 N/A N/A
13 human 55356 SLC22A15 solute carrier family 22, m... XR_426622.1 89% 3UTR 1004 N/A N/A
14 human 79895 ATP8B4 ATPase, class I, type 8B, m... NM_024837.3 89% CDS 3327 N/A N/A
15 human 79895 ATP8B4 ATPase, class I, type 8B, m... NR_073596.1 89% 3UTR 3226 N/A N/A
16 human 79895 ATP8B4 ATPase, class I, type 8B, m... NR_073597.1 89% 3UTR 3179 N/A N/A
17 human 79895 ATP8B4 ATPase, class I, type 8B, m... NR_073598.1 89% 3UTR 3434 N/A N/A
18 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_006720693.1 89% CDS 3336 N/A N/A
19 human 79895 ATP8B4 ATPase, class I, type 8B, m... XM_006720694.1 89% CDS 2740 N/A N/A
20 human 100996490 LINC01206 long intergenic non-protein... NR_104146.1 95% 3UTR 8567 N/A N/A
21 mouse 108682 Gpt2 glutamic pyruvate transamin... XM_006530557.1 89% CDS 1010 N/A N/A
22 mouse 108682 Gpt2 glutamic pyruvate transamin... XM_006530558.1 89% CDS 1193 N/A N/A
23 mouse 70599 Ssfa2 sperm specific antigen 2 XM_006500165.1 90% CDS 79 N/A N/A
24 mouse 242126 Slc22a15 solute carrier family 22 (o... NM_001039371.2 89% CDS 1261 N/A N/A
25 mouse 242126 Slc22a15 solute carrier family 22 (o... XR_375524.1 89% 3UTR 1760 N/A N/A
Download CSV

Sequence Information

Target Sequence:
TGACCCTGAAGTTCATCTGCA
Hairpin Sequence:
5'-CCGG-TGACCCTGAAGTTCATCTGCA-CTCGAG-TGCAGATGAACTTCAGGGTCA-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGTGACCCTGAAGTTCATCTGCACTCGAGTGCAGATGAACTTCAGGGTCATTTTTG-3'
Reverse sequence:
5'-AATTCAAAAATGACCCTGAAGTTCATCTGCACTCGAGTGCAGATGAACTTCAGGGTCA-3'

Other clones with same target sequence:

  1. TRCN0000072199