Construct: shRNA TRCN0000231743

Construct Description:

Construct Type:
shRNA
Other Identifiers:
lacZ_816s21c1
DNA Barcode:
CGCGCCTTTCGGCGGTGAAAT
Vector:
pLKO_TRC005

Original Target:

Taxon:
Control
Gene:
lacZ (-15)
Gene Description:
lacZ
Transcript:
Broad lacZ.1 (CURRENT)
Match location:
Position 816 (CDS)

Current transcripts matched by this hairpin:

Taxon Gene Symbol Description Transcript SDR Match %[?] Region Start Pos.[?] Intrinsic Score[?] Adjusted Score[?]
1 CONTROL -15 lacZ lacZ lacZ.1 100% CDS 816 0.000 N/A
2 CONTROL -42 LacZ Hahn Lab LacZ LacZ.1 100% CDS 801 0.000 N/A
3 human 22941 SHANK2 SH3 and multiple ankyrin re... XM_005277930.2 85% 5UTR 83 N/A N/A
4 human 22941 SHANK2 SH3 and multiple ankyrin re... XM_006718478.2 85% 5UTR 83 N/A N/A
5 human 22941 SHANK2 SH3 and multiple ankyrin re... XM_011544854.1 85% 5UTR 83 N/A N/A
6 human 22941 SHANK2 SH3 and multiple ankyrin re... XM_011544855.1 85% 5UTR 83 N/A N/A
7 human 22941 SHANK2 SH3 and multiple ankyrin re... XM_011544856.1 85% 5UTR 83 N/A N/A
8 human 22941 SHANK2 SH3 and multiple ankyrin re... XM_011544857.1 85% 5UTR 83 N/A N/A
9 human 22941 SHANK2 SH3 and multiple ankyrin re... XM_011544858.1 85% 5UTR 86 N/A N/A
Download CSV

Sequence Information

Target Sequence:
CGCGCCTTTCGGCGGTGAAAT
Hairpin Sequence:
5'-CCGG-CGCGCCTTTCGGCGGTGAAAT-CTCGAG-ATTTCACCGCCGAAAGGCGCG-TTTTTG-3'

Oligo design for arrayed cloning:

Forward sequence:
5'-CCGGCGCGCCTTTCGGCGGTGAAATCTCGAGATTTCACCGCCGAAAGGCGCGTTTTTG-3'
Reverse sequence:
5'-AATTCAAAAACGCGCCTTTCGGCGGTGAAATCTCGAGATTTCACCGCCGAAAGGCGCG-3'

Other clones with same target sequence:

  1. TRCN0000072237